1. literary

    what is the literary term in this sentence. We will continue to work on grammar next week. I postponed our sceheduled test on subject-verb agreement until we got in a little more practice.

    asked by clay on September 24, 2008
  2. pshy

    9. What is the general term Freud used to describe the process whereby the mind protects itself against distress? (Points : 1) Compensation Defense mechanism Rationalization Displacement

    asked by Lisa on March 24, 2012
  3. African church grammar sch

    Cal d total surface area of a solid cone of slant height 15cm and base radius 8cm in term of pie

    asked by Odebiyi on July 4, 2015
  4. Language Arts

    which is the best definition of the term propaganda? A mission statement Creative advertising A proper code of conduct Representation in a misleading manner•• Correct this if you can

    asked by Tj on February 22, 2016
  5. word power

    8. Often applied to politicians, the term _______ suggests hiding one's feelings while obscuring or "spinning" facts. A. simulate B. dissimulate C. vacillate [D. dissemble]

    asked by jake on September 21, 2012
  6. social studies

    Which term best describes the independence movements of both Africa and Asia in the post-World War II era? A.democratic B.fascist C.nationalist D.nonviolent

    asked by WarriorPerson134 on January 7, 2019
  7. MATH

    Can anyone help me with this question.? What term is being described? Choose from these answers: (A)Central Limit Theorem (B)Normal distribution (C)Standard Error (D)Z-score (E)Transformation rules

    asked by Anonymous on April 24, 2015
  8. Social Studies

    Which term best describes the independence movements of both Africa and Asia in the post-World War II era? A. democratic B. fascist C. nationalist D. nonviolent**

    asked by dori on October 21, 2018
  9. American History

    In Virginia, colonists who could pay their way across the Atlantic were granted 50 acres of land to lease for a modest rental fee. The term for such an arrangement was called

    asked by Chrissty on April 5, 2012
  10. Help Me

    Which of the following statements regarding TERM insurance is true ? A. It provides temporary protection B. It builds up cash value C. It pays more than the face amount D. It's more expensive than straight life

    asked by Insurance Problem on November 23, 2010
  11. science

    the term used to describe how light is reflected from a mineral's surface is. A) glow B) luster*** C) density D) streak Im sorry to ask this because I feel its cheating but I really need help on this, can someone check my answer?

    asked by uwu on March 5, 2019
  12. Math

    if 8000 is invested in a long-term trust fund with an interest rate of 5% compounded continuously what is the amount of money in the account after 15 years?

    asked by Ken on January 10, 2019
  13. time and stress management

    once you've determined your long and short term goals you can use ?to determine how to best use your time (a)filing system (b)tickler file (c)monthly calendar (d)to do list really not sure if its c or d could someone please help me

    asked by susue on October 10, 2012
  14. Names in American Society

    In American society, most people take on the last name of their father at their birth. This kind of system is known as what? I've seen someone ask this question on a different site and had wanted to answer them. I thought I had the term. Does it start with

    asked by LR on November 16, 2017
  15. computer science

    Which term best describes a collection of student information and grades that might be similarly displayed in both Excel and Access? A) Database B) Table C) Field D) Record

    asked by Anonymous on March 31, 2011
  16. EARTH SCIENCE

    Do you foresee humans colonizing the planets and moons of our solar system in the long term future of our species? What kind of terraforming would be necessary to make this possible?

    asked by Anonymous on June 29, 2010
  17. psy 202

    8. What is the general term Freud used to describe the process whereby the mind protects itself against distress? (Points : 1) Compensation Defense mechanism Rationalization Displacement

    asked by marla on October 31, 2011
  18. Foreign languages

    Can you check these two questions, please? 1)Who coined the term Lost Generation? Who were its most representative writers? 2) Can you briefly summarise the plot of Fitzgerald’s Great Gatsby.

    asked by Mike on July 3, 2012
  19. Civics

    4.   The term suffrage refers to the  A. freedom to make one's voice heard. B. Soviet labor camps. C. right to vote. D. extermination of Jews under Hitler. C?

    asked by Sarah on March 6, 2015
  20. Psychology

    Explanation of proactive and retroactive interference and how you might counteract their effects while studying in order to facilitate maximum retention via long-term memory

    asked by Angela on September 20, 2013
  21. Grammar

    Write each possessive noun or contraction with an apostrophe. 1. Woodrow Wilson was Americas twenty-eighth president. America's 2. As a student at Princeton, joined the schools debating society. schools' 3. Before becoming president, he served as Princeton

    asked by TiffanyJ on September 21, 2010
  22. Math

    The problem to solve is: (x+20)(x-12)(x+4)>0 but I can't figure out how to do this right so I left off the >0 and tried to solve the equation. x+20 evaluates to x+20 x-12 evaluates to x-12 Multiplying x+20 by x-12 is a classic Algebra problem. Here, you

    asked by Sabrina on September 24, 2010
  23. American Government

    6. What is the only official role of the vice president? A. Lead the national committee on the president's party. B. Organize presidential commissions. C. Preside over the Senate. D. Vote in case of a tie in the Supreme Court. 7. What best describes a

    asked by Hannah on November 8, 2016
  24. Math

    3. What are the next three terms of the sequence 6, 12, 18, 24 a; 28, 34, 40 b; 30, ,34, 38 c; 30, 36, 44 d; 30, 36, 42 --------------------------- 14. The sale price of ground beef at a local grocery store is $1.49 for the first pond and $1.09 for each

    asked by Darcy on May 8, 2014
  25. Peptide Bonds

    Which of the following shows linear sequence of atoms joined by covalent bonds in peptide backbone. a) -N-C-C-N-C-C-N b) -N-C-O-N-C-O- c) -N-C-C-O-N-C-C-O d)-N-H-C-C-N-H-C-C The answer is a). Is that because it's the only one that linear; as in it doesn't

    asked by Lena on March 3, 2011
  26. accounting

    Payment Lag- The lag between purchase date and the date at which pay is due is known as term lag. The lag between the due date and the date on which the buyer actually pays is termed due lag,and lag between the purchase and actually payment dates is the

    asked by James on February 20, 2008
  27. history

    Can someone check my work? Which was a result of the long-term struggles in postcolonial Africa? diverse economies (This one) low population growth modernization dictatorship Which was an impact of the Opium War on China? eliminated foreign trade of opium

    asked by anonymouss on February 25, 2018
  28. R.E

    I can't find any info on harvest festiva Religous education, I presume. The term harvest festival is a recent invention of some Christian groups to promote an alternative to the Halloween festival, which is of pagan origin. All Saints Day is also a

    asked by meme on October 12, 2006
  29. maths

    before lunch time abigal and teresa each read some pages from different books abigal read 5 or one fifth of the pages in her book teresa read 6 or one sixth of the pages in her book whose had more pages how many more pages

    asked by mark on February 11, 2016
  30. FRENCH HELP

    I don't get french It is to hard help me understand plz someone help I can't fail grade six plz help French is the most beautiful language in the world. Thank you for using the Jiskha Homework Help Forum. In order to help you, please give us some examples

    asked by melissa on October 8, 2006
  31. tax accounting

    bruce wilson won 2 million in the state lottery. the lottery pays out the prize money in 20 annual installments of 100,000 each. After receiving three 100,000 installments, bruce sold the remaining 1.7 million of payments for 1 million. He wants to report

    asked by will smithe on June 9, 2011
  32. math

    For the sequence below what are the next 3 elements and why? Please help ASAP!!! :( 3,1,4,5,9,14, ___ , ___ , ___

    asked by Andrea on September 13, 2019
  33. Financial Management

    I need to know how to find the fixed cost and the variable cost along with the break even point using this information. During the sixth month of the fiscal year, the program director of the Westchester Home-Delivered Meals (WHDM) program decides to again

    asked by Sandi on August 16, 2010
  34. science help!!!!!!!!!

    Which sequence of processes must occur for an atom of carbon to go from car to a tree? A.resperation, decomposition B. Combustion, photosynthesis C. Fossilization, decomposition D. Fossilization, photosynthesis Is the answer B?

    asked by butterfly on November 7, 2014
  35. Calculus

    Show how the function y = e^(-x) sin x could represent damped oscillation. a) Determine the local extreme for a sequence of wavelengths. b) Show that the local maxima represent exponential decay.

    asked by Connie wong on June 1, 2017
  36. Algebra

    invest $ 3000 and save $100 each month. Write a rule to represent the total amount of money invest into your account as arithmetic sequence. How much money will you have invested after 12 month?

    asked by Brian on February 17, 2013
  37. finance

    the Wrights found that both Tom and Sue had a life insurance protection gap of $50,000. Present the steps in sequence how Wrights should proceed to search for protection to close that gap?

    asked by vickie on January 24, 2010
  38. Help Math

    A graph of the sequence f(n)=2n-3 and a graph of the function f(x)=2x-3 are both shown What accounts for the differences between the graphs in terms of range? i know only the difference of the domain but i have no idea the difference of the range can

    asked by Edgar on May 9, 2016
  39. Science

    Which sequence of process must occur for an atom of carbon to go from a car to a tree? A. respiration, decomposition B. combustion, photosynthesis C. fossilization, decomposition D. fossilization, photosynthesis

    asked by Mo on January 2, 2015
  40. sCIENCE

    ON WHAt part of the HR diagram would the majority of the main-sequence stars be found? Is that the far corners or middle? There's also top half or bottom half, but I think it's far corners or the middle.

    asked by Tyler on October 14, 2008
  41. maTH

    The owner of Campus Cafe plans to open a second location on a satellite campus in 5yrs. She buys an annuity that pays 10.5% interest compounded annually A. If the payment is $4000 a year, find the future value of the annuity in 5yrs. B. How much more

    asked by plz help asap on April 12, 2016
  42. algebra

    1)Simplify:(3x^0y^-4)(2x^2y)^3 answer=6x^6 over y 2)Simplify:2x^2y^5z^-4 over 8x^6yz^3 answer= y^4 over 4x^4z 3)Saturn is 1.4 x 10^9 kilometers away from the sun. If light travels 3.0 x 10^4 km per second,how long does it take light from the sun to reach

    asked by erin on August 1, 2007
  43. Accounting urgent

    What would be considered quick assets out of Cash& Short term investments......$47.3 receivables.........159.7 inventories...........72.3 prepaid expenses&other current assets...32.0 total current liabilities..........130.0 total

    asked by Arya Pal on February 12, 2015
  44. Science Help!

    Which sequence of processes must occur for an atom of carbon to go from a human to a car? A. Respiration, photosynthesis, decompiosition B. Fossilization, decomposition, respiration C. Photosynthesis, combustion, respiration D. Respiration, fossilzation,

    asked by Callie on November 14, 2014
  45. Maths

    Hey my question is How do we get the triangular numbers sequence ( general statement ) by the quadratic formula ? Can you shoe me steps please ? The triangle numbers are : 1 , 3 , 6 , 10 , 15 how do I get them in the form of a quadratic equation if a , b

    asked by Awmr on March 1, 2010
  46. finance

    suppose the Wrights found that both Tom and Sue had a life insurance protection gap of $50,000. Present the steps in sequence how Wrights should proceed to search for protection to close that gap?

    asked by smith on June 25, 2008
  47. Economics

    21. How do fears of future economic problems affect GDP? A. Businesses will invest more money in the short term to ensure higher profits in the future; GDP will be pushed up. B. Consumers will spend more money in the short term to prevent future economic

    asked by Codey on May 31, 2011
  48. Biology

    When making comparison of sequences where some are whole genome sequences while others are partial genome sequences, or a specific glycoprotein sequence, How is it that we are able to make comparisons from these sequences if they all have different

    asked by Cristian on April 21, 2013
  49. ACT Prep

    Question:So,far Michael has earned the following scores on five 100-point tests this semester: 72, 94, 85, 83, 97. What score must he earn on the sixth 100-point test of the semester if he wants to make an 88 point average for the six tests? Answer Choices

    asked by Will on February 3, 2016
  50. MATH PLEASE HELP MRS.SUE!

    What are the next three terms in the sequence? –1, 9, 19, 29, … (1 point) 38, 37, 32 40, 51, 62 39, 49, 59 38, 47, 56 2. Geoff planted dahlias in his garden. Dahlias have bulbs that divide and reproduce underground. In the first year, Geoff’s garden

    asked by Sally on May 7, 2014
  51. accounting

    ● Case 13-4 Application of SFAC No. 13 On January 1, 2006, Lani Company entered into a non cancelable lease for a machine to be used in its manufacturing operations. The lease transfers ownership of the machine to Lani by the end of the lease term. The

    asked by Anonymous on November 9, 2009
  52. math-finance

    The Colemans finance their home with a $90,000 mortgage loan at 9.25% APR. What will their monthly payments be if the load has a term of 15 years? when i did the calculations i got $926.27 but I'm not sure thats correct Thank you!

    asked by Jonah on October 28, 2018
  53. history

    which of the following was a long-term effect of Prohibition? a. the consumer economy b. the growth of organized crime c. an end to alcoholism in the United States d. the riseof fundamentalism B?..or C?

    asked by history on March 27, 2009
  54. algebra

    How do you simplify this expression, assuming all variables are positive? (3a^1/2b^1/3)^2 The carrot symbol represents exponents. It is a^1/2 and b^1/3, just so you know. Square each term in the parenthesis. 3^2 = 9 (a^1/2)^2 = a (b^1/3)^2 = b^2/3 Put it

    asked by Sally on March 6, 2007
  55. English

    Sigmund Freud coined the term _______,which he applied to people who were extremely self-absorbed. A. Dryad B. suspension of disbelief C. moral D. narcissistic Answer: B?

    asked by Ciara on March 4, 2013
  56. Calculus

    Write the first four nonzero terms and the general term of the Taylor serires for f about x=0. f(x)=2x/(1+x^2) I feel that I'm doing this wrong because finding the derivatives of f(x) look really messy. Can you please show me the steps? Thanks in advance!

    asked by W on February 9, 2012
  57. Written communication

    Often applied to politicians, the term _______ suggests hiding one's feelings while obscuring or "spinning" facts. A. vacillate B. simulate C. dissimulate D. dissemble plz help me

    asked by Tank on August 26, 2014
  58. financial management

    in buyinbg a hone using prepayment verses investment what are the opportunity cost considerations if i was to pay $50.00 extra a month? the way i see this i am oweing more at the end of my loan term.

    asked by jean on November 18, 2007
  59. America history

    In virgina,colonists who could pay their way across the atlantic were granted 50 acres of land to lease for a modest rental fee.the term fro such an arrangement was called?

    asked by Crystal on October 28, 2011
  60. trigonometry

    calculate the angular velocity in radians per minute of ferriswheel 250ft. in diameter that takes 45second to rotate once. express the answer in term of pie

    asked by deyanz on November 29, 2014
  61. Foundations Math 12

    Determine the term of a $46000 investment with an interest rate of 3.9%, compounded monthly, if the future value is $100000. Round your answer to the nearest year. - I know I use the rule of 72 but what do you do after that?

    asked by Leah on February 16, 2014
  62. 7th American History

    Can someone help me please? I have to summarize why John Adams was not reelected in the election of 1800. I know that he wasn't because he declared war on his first term and Thomas Jefferson was a popular candidate, but are there any more reasons?

    asked by Anonymous on October 26, 2016
  63. micro economics

    define the foollowing term using graph and mathimatical expression/utility,util,iso cost ,indiffrnce cure budet line monopolist

    asked by atsede shifera on July 27, 2017
  64. Technology

    Correct me if I'm wrong!! 2. You may see the term FAQ on websites, which stands for Frequently Asked Questions. This is an example of which type of mnemonic? A. poem B. acronym C. acrostic D. abbreviation••

    asked by Vanessa on January 28, 2016
  65. Graphic Design! Pls Answer!

    Which term can be defined as "a collections of glyphs (symbolic figures or letters) that share design features" A Calligraphy B Clip art C Crop D Typeface***

    asked by BLA BLA on January 5, 2018
  66. math 1

    Determine the most probable next term in the list of numbers. Show work to support your answer. 280, 480, 684, 913, 1205, 1615, …

    asked by Anonymous on April 23, 2012
  67. English

    which of the following statements is recommended when doing short term research? A. Use broad search words? B. Visit one site? C. Rely on addresses? D. Choose a specific question

    asked by butt on January 19, 2017
  68. Psychology

    Explain proactive and retroactive interference and how you might counteract their effects while studying in order to facilitate maximum absorption of information into long-term memory.

    asked by tricia on May 22, 2010
  69. history

    What does "BULLY PULPIT" mean and which of our 54 presidents bests represents that term http://www.c-span.org/guide/congress/glossary/bullypul.htm

    asked by Mack on March 26, 2007
  70. History

    What term most accurately defines the radical authoritarian nationalism that emerged in Europe during the early 20th century? A:humanism B:isolationism C:Communism D:fascism Is it D.?

    asked by Bobbi on August 8, 2019
  71. ELA

    which of the following statements is recommended when doing short term research? A. Use broad search words? B. Visit one site? C. Rely on addresses? D. (Choose a specific question)

    asked by Help I need somebody not just anybody on January 26, 2017
  72. Math

    An automobile manufacturing plant produces cars according to a fixed pattern. During one day, the first five cars have the following colors and equipment. blue with a stereo and dark interior white with a stereo and light interior green without a stereo

    asked by Sandy on March 17, 2016
  73. 7th grade Pre-Algebra

    Using the definition, 10(to the negative sixth power) = 1/10to the six power and x(negative2) = 1/xto the second power The definition also shows that 1/10to the six power = 10to the negative 6th power and 1/xto the 2nd power = x(negative2) I think that's

    asked by Dean on September 22, 2009
  74. mRNA

    sometimes a mistake occurs in the stranslation of an mRNA strand. Suppose that the reading of the mRNA stand ATGCCCGCTATCCGACGATAA began, by mistake, at the second nucleotide instead of the the first . Write the sequence ot amino acids that would be formed

    asked by Nghia on October 29, 2011
  75. Biology

    Why would the GBI (Georgia Bureau of Investigation) want to use gel electrophoresis? A. Determine if someone has a genetic disease B. Determine the paternity of a child C. Determine the proper genetic sequence to make insulin D. Determine the identity of a

    asked by Amber on February 2, 2017
  76. fundamental concepts

    Sarah counts her handful of marbles one at a time into a bowl. Each time she puts a marble into the bowl she says the next number name in sequence. This is an example of A. perceptual subitizing. B. classification. C. rote counting. D. rational counting.

    asked by Daniela on February 4, 2015
  77. Math

    Geometry- Three streets intersect with one another. East Street runs horizontally,North Street runs vertically and Fourth Street runs diagonally and intersects both East Street and North Street. What geometric figure do the three streets form?

    asked by Bryce on January 30, 2012
  78. Algebra

    'L' has y-intercept (0,-3) and is parallel to the line with equation y=2/3x+1. (Instructions - write the equation of the line 'L' satisfying the given geometric conditions) We know that two lines that are parallel must have the same slope. So this line

    asked by Bee on August 7, 2007
  79. Algebra (Re.: Reiny)

    The fact that there was that nice symmetry to the question, makes it easier than it first appears. I had it as: (a/b + b/a)÷(b/a - a/b) look at (a/b + b/a) the common denominator for this would be ab, so a/b + b/a = (a^2 + b^2)/ab similarly for (b/a -

    asked by Sara on July 20, 2007
  80. Astronomy

    Which of the following distance measuring techniques works to measure distances to other galaxies beyond the Milky Way? CHECK ALL THAT APPLY A) Hubble's Law B) main sequence stars C) Cepheid variable stars D) parallax E) radar ranging F) galaxy rotation G)

    asked by Dre on November 30, 2010
  81. accounting

    Information about a project Darcy Company is considering is as follows: Investment $1,000,000 Revenues $700,000 Variable costs $140,000 Fixed out-of-pocket costs $80,000 Cost of capital 12% Tax rate 40% The property is considered 5-year property for tax

    asked by jim1 on March 11, 2011
  82. UALR

    Information about a project Darcy Company is considering is as follows: Investment $1,000,000 Revenues $700,000 Variable costs $140,000 Fixed out-of-pocket costs $80,000 Cost of capital 12% Tax rate 40% The property is considered 5-year property for tax

    asked by jldix on March 11, 2011
  83. I need help

    Answer the following questions: i.Which factors are important in multitasking for thread initialization? ii.What is the use of program segment prefix and where is located. iiiWhat is the difference between the interrupt routine and the strategy routine?

    asked by Alina on January 26, 2007
  84. math

    geoff planted dahlias in his garden. dahlias have bulbs that divide and reproduce underground. in the first year, geoff's garden produced 8 bulbs. in the second year, it produced 16 bulbs, and in the third year, it produced 32 bulbs. if this pattern

    asked by s c r e a m i n g on March 27, 2016
  85. Social Studies

    Congress passes a bill- The president veto's a bill- congress overrides the presidential veto Which principle of U.S. government is illustrated in the sequence above? judicial review checks and balances popular sovereignty federalism is it a?

    asked by random person who probly takes the same class as you on May 9, 2016
  86. Math

    A friend opens a savings account by depositing $1000. He deposits an additional $75 into the account each month. a. What is a rule that represents the amount of money in the account as an arithmetic sequence? b. How much money is in the account after 18

    asked by Shakira on January 8, 2014
  87. math

    A friend opens a savings account by depositing $1000. He deposits an additional $75 into the account each month. a. What is a rule that represents the amount of money in the account as an arithmetic sequence? b. How much money is in the account after 18

    asked by Shakira on January 8, 2014
  88. math

    A friend opens a savings account by depositing $1000. He deposits an additional $75 into the account each month. a. What is a rule that represents the amount of money in the account as an arithmetic sequence? b. How much money is in the account after 18

    asked by Shakira on January 8, 2014
  89. Math: proofs

    if f exist in the Riemann integral from [a,b] and if (P_n) is any sequence of tagged partitions of [a,b] such that the norm of these tagged partitions goes to 0 and lim_n S(g,P_n) exists.

    asked by Ashley on November 18, 2015
  90. science

    sequence the steps involved in the making of the cast of a shell 1)sdiment buries shell 2)??? 3)??? 4)mold results 5)??? 6) cast results

    asked by kayla on November 29, 2010
  91. physics

    Given circuits for f and f−1, we can create classical reversible circuits Rf, R−1f, Rf−1, R−1f−1 which are shown in the following figure. (Assume that f is a bijection.)In what sequence shall we apply the above circuits in order to implement a

    asked by s on March 6, 2013
  92. curriculum

    Which of the following is the best definition of phonological awareness? A. Sensitivity to units of sound used in the English language B. Awareness that the speech stream consists of a sequence of sounds or phonemes C. Awareness of the smallest unit of

    asked by Daniela on September 18, 2014
  93. Curriculum

    Which of the following is the best definition of phonological awareness? A. Sensitivity to units of sound used in the English language B. Awareness that the speech stream consists of a sequence of sounds or phonemes C. Awareness of the smallest unit of

    asked by Daniela on September 13, 2014
  94. Art History. HELP!

    1. Which item listed below is NOT a way to determine the age of piece of pottery? a. To examine the style in which it is painted b. Consider the use of color in both design and background c. Examine the shape and uses of a piece d. Consider the size of a

    asked by Abbi on February 18, 2015
  95. Reading/Writing

    I really need help asap with my subjective letter for my NJHS Application. Please answer fast- it is due tomorrow!! --- To the National Juniors Honor Society: I express my gratitude for selecting me, Sandra Garcia, as a possible member of the National

    asked by Sandra on February 3, 2016
  96. Criminal law

    1. The primary purpose of psychological profiling is to provide: A.the identity of an offender involved in a violent crime such as murder or sex crime. B. absolute information about an offender’s emotional and personality character traits and to

    asked by Amy on March 28, 2014
  97. maths

    For the following graph: a. Find the domain of f. b. Find the range of f. c. Find the x-intercepts. d. Find the y-intercept. e. Find the intervals over which f is increasing. f. Find the intervals over which f is decreasing. g. Find the intervals over

    asked by seth on February 18, 2013
  98. Cosmology

    Which of these is NOT a good estimate of the age of the universe? * Decay times of 238U and 232Th in metal-poor stars. * Isochrone fits for globular clusters. * Ages of the faintest white dwarfs. * Ages of the hottest main-sequence stars in distant

    asked by qwerty on January 16, 2013
  99. AlgebraB-2

    A model rocket is launched from a roof into a large field. The path of the rocket can be modeled by the equation y = 0.04x+ 8.3x + 4.3, where x is the horizontal distance, in meters, from the starting point on the roof and y is the height, in meters, of

    asked by Jennifer W. on March 26, 2013
  100. math

    Which statement describes the similarity between sketches and drawings? A Both sketches and drawings are made freehand. B Both sketches and drawings do not require a compass C: Both sketches and drawings do not need drawing tools like a pencil. D. Both

    asked by Help Me on October 3, 2011

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92
  93. 93
  94. 94
  95. 95
  96. 96
  97. 97
  98. 98
  99. 99
  100. 100
  101. 101
  102. 102
  103. 103
  104. 104
  105. 105
  106. 106
  107. 107
  108. 108
  109. 109
  110. 110
  111. 111
  112. 112
  113. 113
  114. 114
  115. 115
  116. 116
  117. 117
  118. 118
  119. 119
  120. 120
  121. 121
  122. 122
  123. 123
  124. 124
  125. 125
  126. 126
  127. 127
  128. 128
  129. 129
  130. 130
  131. 131
  132. 132
  133. 133
  134. 134
  135. 135
  136. 136
  137. 137
  138. 138
  139. 139
  140. 140
  141. 141
  142. 142
  143. 143
  144. 144
  145. 145
  146. 146
  147. 147
  148. 148
  149. 149
  150. 150
  151. 151
  152. 152
  153. 153
  154. 154
  155. 155
  156. 156
  157. 157
  158. 158
  159. 159
  160. 160
  161. 161
  162. 162
  163. 163
  164. 164
  165. 165
  166. 166
  167. 167
  168. 168
  169. 169
  170. 170
  171. 171
  172. 172
  173. 173
  174. 174
  175. 175
  176. 176
  177. 177
  178. 178
  179. 179
  180. 180
  181. 181
  182. 182
  183. 183
  184. 184
  185. 185
  186. 186
  187. 187
  188. 188
  189. 189
  190. 190
  191. 191
  192. 192
  193. 193
  194. 194
  195. 195
  196. 196
  197. 197
  198. 198
  199. 199
  200. 200
  201. 201
  202. 202
  203. 203
  204. 204
  205. 205
  206. 206
  207. 207
  208. 208
  209. 209
  210. 210
  211. 211
  212. 212
  213. 213
  214. 214
  215. 215
  216. 216
  217. 217
  218. 218
  219. 219
  220. 220
  221. 221
  222. 222
  223. 223
  224. 224
  225. 225
  226. 226
  227. 227
  228. 228
  229. 229
  230. 230
  231. 231
  232. 232
  233. 233
  234. 234
  235. 235
  236. 236
  237. 237
  238. 238
  239. 239
  240. 240
  241. 241
  242. 242
  243. 243
  244. 244
  245. 245
  246. 246
  247. 247
  248. 248
  249. 249
  250. 250
  251. 251
  252. 252
  253. 253
  254. 254
  255. 255
  256. 256
  257. 257
  258. 258
  259. 259
  260. 260
  261. 261
  262. 262
  263. 263
  264. 264
  265. 265
  266. 266
  267. 267
  268. 268
  269. 269
  270. 270
  271. 271
  272. 272
  273. 273
  274. 274
  275. 275
  276. 276
  277. 277
  278. 278
  279. 279
  280. 280
  281. 281
  282. 282
  283. 283
  284. 284
  285. 285
  286. 286
  287. 287
  288. 288
  289. 289
  290. 290
  291. 291
  292. 292
  293. 293
  294. 294
  295. 295
  296. 296
  297. 297
  298. 298
  299. 299
  300. 300
  301. 301
  302. 302
  303. 303
  304. 304
  305. 305
  306. 306
  307. 307
  308. 308
  309. 309
  310. 310
  311. 311
  312. 312
  313. 313
  314. 314
  315. 315
  316. 316
  317. 317
  318. 318
  319. 319
  320. 320
  321. 321
  322. 322
  323. 323
  324. 324
  325. 325
  326. 326
  327. 327
  328. 328
  329. 329
  330. 330
  331. 331
  332. 332
  333. 333
  334. 334
  335. 335
  336. 336
  337. 337
  338. 338
  339. 339
  340. 340
  341. 341
  342. 342
  343. 343
  344. 344
  345. 345
  346. 346
  347. 347
  348. 348
  349. 349
  350. 350
  351. 351
  352. 352
  353. 353
  354. 354
  355. 355
  356. 356
  357. 357
  358. 358
  359. 359
  360. 360
  361. 361
  362. 362
  363. 363
  364. 364
  365. 365
  366. 366
  367. 367
  368. 368
  369. 369
  370. 370
  371. 371
  372. 372
  373. 373
  374. 374
  375. 375
  376. 376
  377. 377
  378. 378
  379. 379
  380. 380
  381. 381
  382. 382
  383. 383
  384. 384
  385. 385
  386. 386
  387. 387
  388. 388
  389. 389
  390. 390
  391. 391
  392. 392
  393. 393
  394. 394
  395. 395
  396. 396
  397. 397
  398. 398
  399. 399
  400. 400
  401. 401
  402. 402
  403. 403
  404. 404
  405. 405
  406. 406
  407. 407
  408. 408
  409. 409
  410. 410
  411. 411
  412. 412
  413. 413
  414. 414
  415. 415
  416. 416
  417. 417
  418. 418
  419. 419
  420. 420
  421. 421
  422. 422
  423. 423
  424. 424
  425. 425
  426. 426
  427. 427
  428. 428
  429. 429
  430. 430
  431. 431
  432. 432
  433. 433
  434. 434
  435. 435
  436. 436
  437. 437
  438. 438
  439. 439
  440. 440
  441. 441
  442. 442
  443. 443
  444. 444
  445. 445
  446. 446
  447. 447
  448. 448
  449. 449
  450. 450
  451. 451
  452. 452
  453. 453
  454. 454
  455. 455
  456. 456
  457. 457
  458. 458
  459. 459
  460. 460
  461. 461
  462. 462
  463. 463
  464. 464
  465. 465
  466. 466
  467. 467
  468. 468
  469. 469
  470. 470
  471. 471
  472. 472
  473. 473
  474. 474
  475. 475
  476. 476
  477. 477
  478. 478
  479. 479
  480. 480
  481. 481
  482. 482
  483. 483
  484. 484
  485. 485
  486. 486
  487. 487
  488. 488
  489. 489
  490. 490
  491. 491
  492. 492
  493. 493
  494. 494
  495. 495
  496. 496
  497. 497
  498. 498
  499. 499
  500. 500
  501. 501
  502. 502
  503. 503
  504. 504
  505. 505
  506. 506
  507. 507
  508. 508
  509. 509
  510. 510
  511. 511
  512. 512
  513. 513
  514. 514
  515. 515
  516. 516
  517. 517
  518. 518
  519. 519
  520. 520
  521. 521
  522. 522
  523. 523
  524. 524
  525. 525
  526. 526
  527. 527
  528. 528
  529. 529
  530. 530
  531. 531
  532. 532
  533. 533
  534. 534
  535. 535
  536. 536
  537. 537
  538. 538
  539. 539
  540. 540
  541. 541
  542. 542
  543. 543
  544. 544
  545. 545
  546. 546
  547. 547
  548. 548
  549. 549
  550. 550
  551. 551
  552. 552
  553. 553
  554. 554
  555. 555
  556. 556
  557. 557
  558. 558
  559. 559
  560. 560
  561. 561
  562. 562
  563. 563
  564. 564
  565. 565
  566. 566
  567. 567
  568. 568
  569. 569
  570. 570
  571. 571
  572. 572
  573. 573
  574. 574
  575. 575
  576. 576
  577. 577
  578. 578
  579. 579
  580. 580
  581. 581
  582. 582
  583. 583
  584. 584
  585. 585
  586. 586
  587. 587
  588. 588
  589. 589
  590. 590
  591. 591
  592. 592
  593. 593
  594. 594
  595. 595
  596. 596
  597. 597
  598. 598
  599. 599
  600. 600
  601. 601
  602. 602
  603. 603
  604. 604
  605. 605
  606. 606
  607. 607
  608. 608
  609. 609
  610. 610
  611. 611
  612. 612
  613. 613
  614. 614
  615. 615
  616. 616
  617. 617
  618. 618
  619. 619
  620. 620
  621. 621
  622. 622
  623. 623
  624. 624
  625. 625
  626. 626
  627. 627
  628. 628
  629. 629
  630. 630
  631. 631
  632. 632
  633. 633
  634. 634
  635. 635
  636. 636
  637. 637
  638. 638
  639. 639
  640. 640
  641. 641
  642. 642
  643. 643
  644. 644
  645. 645
  646. 646
  647. 647
  648. 648
  649. 649
  650. 650
  651. 651
  652. 652
  653. 653
  654. 654
  655. 655
  656. 656
  657. 657
  658. 658
  659. 659
  660. 660
  661. 661
  662. 662
  663. 663
  664. 664
  665. 665
  666. 666
  667. 667
  668. 668
  669. 669
  670. 670
  671. 671
  672. 672
  673. 673
  674. 674
  675. 675
  676. 676
  677. 677
  678. 678
  679. 679
  680. 680
  681. 681
  682. 682
  683. 683
  684. 684
  685. 685
  686. 686
  687. 687
  688. 688
  689. 689
  690. 690
  691. 691
  692. 692
  693. 693
  694. 694
  695. 695
  696. 696
  697. 697
  698. 698
  699. 699
  700. 700
  701. 701
  702. 702
  703. 703
  704. 704
  705. 705
  706. 706
  707. 707
  708. 708
  709. 709
  710. 710
  711. 711
  712. 712
  713. 713
  714. 714
  715. 715
  716. 716
  717. 717
  718. 718
  719. 719
  720. 720
  721. 721
  722. 722
  723. 723
  724. 724
  725. 725
  726. 726
  727. 727
  728. 728
  729. 729
  730. 730
  731. 731
  732. 732
  733. 733
  734. 734
  735. 735
  736. 736
  737. 737
  738. 738
  739. 739
  740. 740
  741. 741
  742. 742
  743. 743
  744. 744
  745. 745
  746. 746
  747. 747
  748. 748
  749. 749
  750. 750
  751. 751
  752. 752
  753. 753
  754. 754
  755. 755
  756. 756
  757. 757
  758. 758
  759. 759
  760. 760
  761. 761
  762. 762
  763. 763
  764. 764
  765. 765
  766. 766
  767. 767
  768. 768
  769. 769
  770. 770
  771. 771
  772. 772
  773. 773
  774. 774
  775. 775
  776. 776
  777. 777
  778. 778
  779. 779
  780. 780
  781. 781
  782. 782
  783. 783
  784. 784
  785. 785
  786. 786
  787. 787
  788. 788
  789. 789
  790. 790
  791. 791
  792. 792
  793. 793
  794. 794
  795. 795
  796. 796
  797. 797
  798. 798
  799. 799
  800. 800
  801. 801
  802. 802
  803. 803
  804. 804
  805. 805
  806. 806
  807. 807
  808. 808
  809. 809
  810. 810
  811. 811
  812. 812
  813. 813
  814. 814
  815. 815
  816. 816
  817. 817
  818. 818
  819. 819
  820. 820
  821. 821
  822. 822
  823. 823
  824. 824
  825. 825
  826. 826
  827. 827
  828. 828
  829. 829
  830. 830
  831. 831
  832. 832
  833. 833
  834. 834
  835. 835
  836. 836
  837. 837
  838. 838
  839. 839
  840. 840
  841. 841
  842. 842
  843. 843
  844. 844
  845. 845
  846. 846
  847. 847
  848. 848
  849. 849
  850. 850
  851. 851
  852. 852
  853. 853
  854. 854
  855. 855
  856. 856
  857. 857
  858. 858
  859. 859
  860. 860
  861. 861
  862. 862
  863. 863
  864. 864
  865. 865
  866. 866
  867. 867
  868. 868
  869. 869
  870. 870
  871. 871
  872. 872
  873. 873
  874. 874
  875. 875
  876. 876
  877. 877
  878. 878
  879. 879
  880. 880
  881. 881
  882. 882
  883. 883
  884. 884
  885. 885
  886. 886
  887. 887
  888. 888
  889. 889
  890. 890
  891. 891
  892. 892
  893. 893
  894. 894
  895. 895
  896. 896
  897. 897
  898. 898
  899. 899
  900. 900
  901. 901
  902. 902
  903. 903
  904. 904
  905. 905
  906. 906
  907. 907
  908. 908
  909. 909
  910. 910
  911. 911
  912. 912
  913. 913
  914. 914
  915. 915
  916. 916
  917. 917
  918. 918
  919. 919
  920. 920
  921. 921
  922. 922
  923. 923
  924. 924
  925. 925
  926. 926
  927. 927
  928. 928
  929. 929
  930. 930
  931. 931
  932. 932
  933. 933
  934. 934