Find all positive values for k for which each of the following can be factored. I have 2 problems i think i got the one right but not sure the second one i have no idea where to even start 2x^3+16x^2-40x=2x(x^2+8x-20) (x-2)(x+10)=8x this one i am stumped

    asked by TAMMY on April 25, 2007
  2. Math

    Find the limit of the sequence 2ln(1+3n) - ln(4+n^2) What I did: lim as n approach inf of an = 2*lim ln (1+3n)/(4+n^2) = 2 * lim ln (1/n^2 + 3n/n^2) / (4/n^2 + n^2/n^2) = 2 * lim ln (1/n^2 + 3/n) / (4/n^2 + 1) = 2 * lim ln (1/inf^2 + 3/inf) / (4/inf^2 +1)

    asked by Helloo on April 25, 2019
  3. math

    The number uses every number 0-9 the numbers are used only once the fourth digit is 4 the first digit in the billions place is 3 the 5 is next to the last digit the sixth digit is 7 the digit after 3 is 9 the digit before 5 is 2the third digit is half the

    asked by Anonymous on October 20, 2011
  4. Science

    1.)When evaluation was first processed which of the following was used as evidence to suport the idea (1 point) a.)observations of nature**** b.)laboratory experiments c.)extensive fossil collections b.)genetic sequence 2.)a farmer sprays insecticide on

    asked by Hannah on October 2, 2014
  5. Physics

    A child is playing with a remote-controlled racecar on the fire escape of a sixth-floor apartment. An accidental turn sends the car through the railing and over the edge of the fire escape. Explain why the time it takes for the car to fall does not depend

    asked by Wei on December 11, 2016
  6. algebra

    1.)correct 2.)wrong---> the first term is wrong 4(3a^2)^2 = 36a^4 3.) not sure on this one 4.) wrong---> - square root of six is not a solution Hope this Helps! 1)find p(-3)if p(x)=4x^3-5x^2+7x-10 =-184 2)If r(x)=4x^2-3x+7,find r(3a^2) =12a^4-9a^2+7

    asked by manny on August 16, 2007
  7. BIO 12

    BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A

    asked by Stephanie on September 24, 2015
  8. Psychology

    Brief summary and example of these Cognitive Learning Strategies/types please? I don't have my book yet and I need these ASAP!!!!! Ex: Three-stage information processing model is which includes a short definition or description of (a) sensory-register, (b)

    asked by Williams on May 25, 2014
  9. Maths

    In a box of chocolates, •one-fifth are plain chocolate •one-sixth are white chocolate •the other 38 are milk chocolate. How many chocolates are there in the box?

    asked by Amy on July 16, 2016
  10. algebra

    you have a mean score of 84 after taking 5 100 point tests. What do you need to score on the sixth 100-point test to have a mean score of 85?

    asked by malik on October 2, 2008
  11. Physics

    In the Biomedical and Physical Sciences building at MSU there are 135 steps from the ground floor to the sixth floor. Each step is 16.0 cm tall. It takes 5 minutes and 40 seconds for a person with a mass of 63.9 kg to walk all the way up. How much work did

    asked by Kevin on April 19, 2016
  12. Physics

    In the Biomedical and Physical Sciences building at MSU there are 135 steps from the ground floor to the sixth floor. Each step is 16.0 cm tall. It takes 5 minutes and 40 seconds for a person with a mass of 63.9 kg to walk all the way up. How much work did

    asked by Kevin on April 19, 2016
  13. Math

    Help, I can't find the pattern rule for this sequence(eg. -6,-3,2,9,18 and the pattern rule is n squared-7) The pattern: 6,28,64,114,178. What's the pattern rule? The pattern: 96,84,64,36. What's the pattern rule? The pattern: 0,24,216,960. What's the

    asked by Abigail on November 2, 2011
  14. Math

    If you run 3 miles everyday for 5 days, how many miles will you need to run on the sixth day in order to have run an average of 4 miles per day over 6 days? Solve this problem in two different ways, and explain your solutions.

    asked by Miles on April 5, 2017
  15. algebra

    Okay, how do you factor a polynomial when there is a number in front of the highest x term. For example: how would you factor 2x^2-11x+15 i know the answer is (2x-5)(x-3), right? So you put the 2x on one side and then you put an x on the other. And then

    asked by Fidelia on May 15, 2007
  16. maths

    the sum of the 4th and 6th terms of an A.P is 42. the sum of the 3rd and 9th terms of the progression is 52. find the first term, the common difference and the sum of the first ten terms of the progression.

    asked by festus on March 7, 2012
  17. math

    1. A die is tossed 10 times and the number of sixes rolled is recorded. The number of sixes rolled will follow what type of distribution? a. poison b. binomial c. geometric d. normal

    asked by kenneth on January 4, 2011
  18. problem solving

    What rectangular regions could be enclosed? Areas? Organize a table? Make a graph? Which rectangular region has the most area? from a table? from a graph? from algebra, using the arithmetic mean-geometric mean inequality?

    asked by kakak on December 8, 2014
  19. Math

    Ama, Karla and Daniel are siblings. Ama is 3 years older than Karla and Daniel is 2 years older than Ama.The sum of their ages is 32. How old is each child. Please help me I don't know what to do, it's my High School Summer Holiday Homework!!! But I'm

    asked by Laiba on June 25, 2016
  20. math

    Again, I already know this answer... It's 12 but I do not know how to come up with this answer. Plz show me step by step how to come up with the correct answer. My test is tomorrow. Thank you in advance!! A basketball player averaged 20 points a game over

    asked by cindi on February 10, 2015
  21. math

    86, 64, 24...What is the next term?

    asked by sheyrl on September 12, 2010
  22. Math

    The 8 term of a g.p is 7/32

    asked by Tracy on November 11, 2018
  23. Algebra 2

    What is the third term of (x^2 + 3y)^3

    asked by Lan Zhan on July 29, 2019
  24. Survey of mathematics

    On January 5, Ebony Davis borrowed $6,500 on a simple interest loan from a lending institution to finance her catering business. She borrows the money at a rate of 8.5% with a term ending on December 9. a. Calculate Ebony's interest on the simple interest

    asked by Jennifer on June 20, 2014
  25. Survey of Mathematics

    On January 5, Ebony Davis borrowed $6,500 on a simple interest loan from a lending institution to finance her catering business. She borrows the money at a rate of 8.5% with a term ending on December 9. a. Calculate Ebony's interest on the simple interest

    asked by Jennifer on June 22, 2014
  26. alberbra

    The parliament of the land of Archronia consists of two houses. The Parliament was elected in 1995 for a period of four years beginning on Monday, January 1st, 1996, when the two houses had their first sessions. According to the rules, the meetings of the

    asked by Alex on July 27, 2008
  27. Urgent! Help please!

    On January 5, Ebony Davis borrowed $6,500 on a simple interest loan from a lending institution to finance her catering business. She borrows the money at a rate of 8.5% with a term ending on December 9. a. Calculate Ebony's interest on the simple interest

    asked by Jennifer on June 20, 2014
  28. Algebra

    Is there a shortcut to foiling an equation? I always thought that FOIL WAS a shortcut. I've never heard of "foil" before :) FOIL (First Inner Outer Last) Does this just specify an order in which you are supposed to multiply? I think the order is

    asked by jennifer on December 21, 2006
  29. 9th grade algebra (factoring with quadratic)

    Can you check the following problems? 4. x^2 - 10x +25 = 9 x^2 - 10x + (25 -9) = 9 - 9 x^2 - 10x + 16 = 0 (x - 8)(x-2) = 0 x - 8 = 0, x - 2 = 0 x = 8, x = 2 5. x^2 - 6x + 9 = 49 x^2 - 6x + ( 9 - 49) = 49 - 49 x^2 - 6x - 40 = 0 (x -10)(x + 4) = 0 x - 10 =

    asked by Alexis on November 1, 2016
  30. Math

    1. Georgie wants to make a cake. She needs to use 2L of milk for each tier. If she has 6 tiers how many liters of milk does she use? A. 12 **** B. 64 C. 6 D. 2 Part 1. Angle makes 17 braclets for her friends. Each braclet uses 21 beads. If Angle wanted to

    asked by Likewhat?! on March 24, 2019
  31. math

    Write an explicit formula for the sequence one-half, three-sevenths, one-third, five-nineteenths, three-fourteenths, ... Then find a14. (1 point) an = an – 1 – n minus one over seven n; fifteeen over one hundred nintey nine an = a sub n plus one over n

    asked by paige on February 26, 2013
  32. Algebra

    3 real numbers that form a geometric progression have sum equal to 175 and product equal to 17576. What is the sum of the largest and smallest numbers?

    asked by John on March 18, 2013
  33. geometry

    Which geometric figure could not be drawn using both perpendicular line segements and parallel line segements? A.a pentagon B. a rectangle C. a trapezoid D. a triangle IS the answer(D) a triangle

    asked by Marie on February 13, 2010
  34. Maths

    By expanding the inequality(the square root of A-the square root of B)^2>0,show that the arithmetic mean of two unequal numbers is greater than their geometric mean.Check by using the numbers a)10 b)2root2 c)2/3

    asked by Efa on July 28, 2016
  35. math

    Explain the difference between the following pairs of geometric figures: a simple closed curve and a nonsimple closed curve a convex polygon and a nonconvex polygon

    asked by thomas on October 7, 2009
  36. Algebra

    3 real numbers that form a geometric progression have sum equal to 175 and product equal to 17576. What is the sum of the largest and smallest numbers?

    asked by Joe on March 18, 2013
  37. Math. easy?

    On his 13th birthday he was 112cm tall and on his 14th birthday he was 121cm tall. Assume a geometric monthly growth rate. What is this rate? I just need to know how to set it up. Please and thanks

    asked by Cody on October 14, 2012
  38. Algebra

    Write the equation of the line L satisfying the given geometric conditions. L has y-intercept (0,2) and is perpendicular to the line with equation 2x-3y=6 Show work I will be happy to critique your work on this. 3x+2y=4?

    asked by Linda on May 20, 2007
  39. sum geometric series

    what is the sum of geometric infinite series 3/2+ 9/16+ 27/128+ 81/1024=.... i know the formula is S=a/(1-r) my teacher, he usually transforms into a formula of the sum series and finds out a and r.but i don't how to do that. the pattern i saw is 3/2 +

    asked by david on April 9, 2007
  40. math

    Patsy has cheer-leading practice every fourth day. She wants to be in the school play, but they have practice every sixth day. If both start on September 5th, what would be the next date she has to choose between cheer-leading and play practice? Explain.

    asked by jena on December 15, 2015
  41. Psychology

    Avis put off writing her term paper until three days before it was due. "It's not that big of a deal. I can whip it out in a couple of hours," she thought. As it turned out, this was not the case. She averaged two hours a night sleep as she struggled to

    asked by Angela on May 20, 2013
  42. Psychology

    Avis put off writing her term paper until three days before it was due. "It's not that big of a deal. I can whip it out in a couple of hours," she thought. As it turned out, this was not the case. She averaged two hours a night sleep as she struggled to

    asked by Tobbo on June 5, 2011
  43. Psychology

    Avis put off writing her term paper until three days before it was due. "It's not that big of a deal. I can whip it out in a couple of hours," she thought. As it turned out, this was not the case. She averaged two-hours-a-night sleep as she struggled to

    asked by Kasey on November 7, 2011
  44. Psychology

    Avis put off writing her term paper until three days before it was due. "It's not that big of a deal. I can whip it out in a couple of hours," she thought. As it turned out, this was not the case. She averaged two hours a night sleep as she struggled to

    asked by Nicci on July 25, 2011
  45. conjectures

    Evaluate the following sums: 1 1+8 1+8+27 1+8+27+64 Add two more line to the list, and make a conjecture about the sums you obtained. this is a pattern. if you look closely than you'll see each number is a product of another number cubed.

    asked by Shay on February 25, 2007
  46. Chemistry

    Take a look at the following uses of the term entropy by several historical figures: Anton Chekhov considered by some as being one of the greatest short story writers said, "Only entropy comes easy." Vaclav Havel, playwright and the first president of the

    asked by Tina on June 3, 2018
  47. Literature

    'Write about how Vita, from Helen on eighty-sixth street is realistic or non-realistic to you.' Vita, to me, is realistic. Many other girls her age might envy a classmate and want beauty, even though they probably don't know the Greek myths as much as her.

    asked by mysterychicken on November 19, 2009
  48. statistics

    Find the first arithmetic mean between 100 and 135 given the following sequence: ..., 100, ___, ___, ___, ___, 135, ...

    asked by emily on August 25, 2011
  49. Math (Reimy)

    Ok Reimy the question came with the ans x=3 then y=2.2, i made t he mistake and put it to two decimal places not realising tehy sequence is one, i will try to be more careful in the future. How did you come up with 20.25 to divide by 20?

    asked by Keira on June 27, 2009
  50. English

    Summarize the sequence of events leading to the writers proposal to mimmy.in your summary,highlight the details of the couples journey to finding love.

    asked by Nomcebo on March 3, 2013
  51. Math

    Let $|r| < 1$, $$S = \sum_{k=0}^{\infty} r^k,$$ and $$T = \sum_{k=0}^{\infty} k r^k.$$ Our approach is to write $T$ as a geometric series in terms of $S$ and $r$. Give a closed form expression for $T$ in terms of $r$.

    asked by TheDude on January 16, 2016
  52. Math

    On his 13th birthday he was 112 cm tall and on his 14th birthday he was 121cm tall. Assume a geometric monthly growth rate. What is this rate? (%)

    asked by Megan on October 13, 2012
  53. MATH

    Patsy has cheer leading practice every fourth day. She wants to be in the school play. but they have practice every sixth day. If both start on September 5th. what would be the next date she has to choose between cheer leading and play practice? the answer

    asked by princess on November 11, 2015
  54. Career Planning

    1.Which of the following is the term for day-to-day and long-term tasks you are assigned to complete? A.Career Research********* B.Job Responsibilities C.Job Title D.Training Materials 2. Why is career planning important? A.You will only have one career.

    asked by first on August 21, 2019
  55. Mathematrics

    Each diagram in the sequence is obtained by drawing of a 1 unit square on each side that forms the perimeter of the previous diagram, the 1st digram contains (1) square, the 2nd diagram (4) squares and the 3rd diagram (13) squares, I would like to know how

    asked by Brittany on June 17, 2009
  56. art103

    Describe the shapes in this painting. Are the shapes organic or geometric? Which ones? Describe how the shapes interact, or "touch" each other. Are the edges of the shapes soft or hard? Do they bump, blend, or overlap? Support your answers with specific

    asked by abdulkadir on February 8, 2015
  57. Math

    5.Jack participated in a 6 day bike marathon of 430 kilometers. He biked 90 kilometers on each of the first 4 days and y kilometers on the fifth day. Which equation can be used to find b, the number of kilometers Jack biked on the sixth day?

    asked by Jerald on June 4, 2013
  58. math

    I do not understand how to Give the five-number summary of each set of numbers. Can someone please help me? 7, 7, 5, 4, 1, 9, 8, 8, 8, 5, 2 http://en.wikipedia.org/wiki/Five-number_summary start by putting the numbers in order. 1,2,4,5,5,7,7,8,8,8,9 The

    asked by Wendy on June 3, 2007
  59. Math

    A sixth-grade class completed a survey about favorite foods. Of the students in the class 2/6 chose hamburgers, and 3/8 chose pizza. What fraction of the class chose either hamburgers or pizza.?

    asked by Acacia on December 31, 2012
  60. Math

    help me solve this conic: 12x^2+y^2+6x-9=0 not sure what you mean by "solve this conic" You want to know what kind of conic? ellipse to find out its properties you have to change it into standard form (x-h)^2/a^2 + (y-k)^2/b^2 = 1 I would first divide by

    asked by Blake on April 2, 2007
  61. Calc

    intergral of (x^3 -4x + 3)/(2x) dx would this be ln abs(x^3-4x+3) + C? I don't really understand how to solve this problem. d/dx (tan (x^2)) sec^2(x^2)(2x) would this be the correct answer to find the derivative of tan (x^2)? no, because if you

    asked by Tammy on May 2, 2007
  62. Grammar and Composition

    ok, after i posted this yesterday: ok, now that i have my pet peeve, i have to fill out this sheet. (please read my earlier post for more info on the assignment) Pet Peeve--Organizational Sheet Audience: Who will be your audience? You must indicate an

    asked by y912f on November 9, 2009
  63. Earth Science

    1. Which term refers to the way light interacts with the surface of a rock or mineral? cleavage- luster density hardness 2.What will happen in an area where large deposits of a desired mineral are found? Select the two correct answers. Tourism in the area

    asked by Pika-Chu on September 20, 2019
  64. Science

    1. Which term refers to the way light interacts with the surface of a rock or mineral? cleavage- luster density hardness 2.What will happen in an area where large deposits of a desired mineral are found? Select the two correct answers. Tourism in the area

    asked by 모르겠어 on September 24, 2019
  65. algebra

    Solve for x x/6-x/8 equals 1 Do fraction busters Find the least common denominator, which is 24. Change the fractions to where they have the same denominator. Change 1 to equal 24/24, and solve. Did this help? x/6 + x/8 = 1 multiply each term by 24, the

    asked by Tony on April 24, 2007
  66. Algebra

    Can someone please explain how to do these problems. 1)write a polynomial function of least degree with intregal coefficients whose zeros include 4 and 2i. 2)list all of the possible rational zeros of f(x)= 3x^3-2x^2+7x+6. 3)Find all of the rational zeros

    asked by Marissa on August 10, 2007
  67. math

    kate cut a pizza into fourths. karl cut a pizza of the same size into sixth. After they each ate some pizza, they had the same fraction of pizzas left. What fraction of each pizza was left?

    asked by tyler on April 23, 2013
  68. algebra

    Find two consecutive positive integers such that the sum of their squares is 85. n^2+(n+1)^2+2n = 85 n^2+n^2+2n+1=85 2n^2+2n=84 n^2+n=42 n^2+n-42=0 (n-6)(n+7)=0 n=6 n=-7 Is my work and answer correct? -7 is not a positive integer. Your first equation is

    asked by carla on July 14, 2007
  69. MATH!!

    TO be on the 1-km race team, Celia must have a mean time less than 5 min 50 secs in 6 tryout games. Her times in 5 races are: 6 min 2 s, 5 min 53 s, 5 min 53 s, 5 min 45 s, 6 min, and 5 min 34 s. WHat itme should Celia aim for in her sixth race to make the

    asked by beeca on February 10, 2009
  70. statistics

    A box contains 19 red marbles and 19 green marbles. Sampling at random from the box five times with replacement, you have drawn a red marble all five times. What is the probability of drawing a red marble the sixth time?

    asked by lucy on October 12, 2014
  71. Technology

    1. Using a graphic organizer in the prewriting process can do all of the following except: A. organize the writers thoughts B. help narrow the writers topic C. research a writers story** D. help make the writing more detailed 2. Writing a story with proper

    asked by Nina on October 6, 2015
  72. hayley

    Hayley, I have read a number of posts of yours, and noticed two things. a. you worry about grades far too much, after all, we have an entire life ahead of us. Perfection is not on the cards for most of us. b. you have an issue in reading comprehension, in

    asked by bobpursley on August 15, 2017
  73. science

    what is another term for states

    asked by mic on October 6, 2009
  74. MATH

    What is the 9th term -1/18 1/6 -1/2

    asked by M on June 15, 2011
  75. algebra 2

    what is the 35th term of 5+11+17.....?

    asked by Sue diaz on May 16, 2010
  76. mat/116 week 9 final exam

    what is the like term of 11c+4d-9c-7d=

    asked by micky on April 11, 2010
  77. ecology

    what is the term for community

    asked by ashley on April 6, 2009
  78. math

    what is 8+10+2/12+4/9 in lowest term if possible

    asked by abby on July 30, 2011
  79. math

    1,1,2.3,5....... what can be the general term for this?

    asked by Riana on January 1, 2013
  80. Math (Help please)

    What are the like terms of -x, -8x^2, and -2. What is the like term of 5 j^2 k^2?

    asked by Zero on February 26, 2015
  81. math help!

    48,36,27,81/4........... general term?

    asked by Riana on January 1, 2013
  82. Culinary arts

    What does the term coving mean?

    asked by Brooke on January 29, 2012
  83. math

    1/6,1/2,5/6,....... What is the general term for this?

    asked by Raina on December 27, 2012
  84. math

    what is 20/30 in lowest term

    asked by zackery on November 3, 2015
  85. Math

    what is the like term method ?

    asked by Juan on August 30, 2010
  86. psychology

    the term "insanity" is used

    asked by sarah on May 5, 2012
  87. science

    The term colon is often used instead of

    asked by john on September 29, 2010
  88. maths

    which is the 19th term of 4n+3

    asked by shamha on February 11, 2017
  89. math

    What is the 8th term of (3x-1/2y)^10

    asked by corey on May 23, 2011
  90. Math

    The 8th term of 40,10, 5/2, 5/8

    asked by Rosie on March 4, 2016
  91. math

    (x - 2)10; 8th term

    asked by mico on March 13, 2016
  92. math

    4,27,256,? Which is the next term

    asked by chirag on December 26, 2015
  93. math

    what would be the 6th term, 1,2/3,4/9,8/27,16/81

    asked by gena on May 11, 2010
  94. math

    what is the tenth term

    asked by charlie on September 5, 2014
  95. Math -- nth term

    What is nth term of 41?

    asked by Ms. Sue on March 30, 2019
  96. Math

    General term of 2x-1, 3x+1, 4x+3, 5x+5

    asked by Titin on September 11, 2016
  97. Ethnic Diversity

    what exactly does the term Orientalism mean?

    asked by Anonymous on April 23, 2010
  98. english

    What does the term arbitrary mean?

    asked by nancy on December 13, 2007
  99. Calculus

    Consider the function f(x)=sin(1/x) Find a sequence of x-values that approach 0 such that (1) sin (1/x)=0 {Hint: Use the fact that sin(pi) = sin(2pi)=sin(3pi)=...=sin(npi)=0} (2) sin (1/x)=1 {Hint: Use the fact that sin(npi)/2)=1 if n= 1,5,9...} (3) sin

    asked by George on September 9, 2008
  100. Calculus

    Consider the function f(x)=sin(1/x) Find a sequence of x-values that approach 0 such that (1) sin (1/x)=0 {Hint: Use the fact that sin(pi) = sin(2pi)=sin(3pi)=...=sin(npi)=0} (2) sin (1/x)=1 {Hint: Use the fact that sin(npi)/2)=1 if n= 1,5,9...} (3) sin

    asked by George on September 9, 2008


  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92
  93. 93
  94. 94
  95. 95
  96. 96
  97. 97
  98. 98
  99. 99
  100. 100
  101. 101
  102. 102
  103. 103
  104. 104
  105. 105
  106. 106
  107. 107
  108. 108
  109. 109
  110. 110
  111. 111
  112. 112
  113. 113
  114. 114
  115. 115
  116. 116
  117. 117
  118. 118
  119. 119
  120. 120
  121. 121
  122. 122
  123. 123
  124. 124
  125. 125
  126. 126
  127. 127
  128. 128
  129. 129
  130. 130
  131. 131
  132. 132
  133. 133
  134. 134
  135. 135
  136. 136
  137. 137
  138. 138
  139. 139
  140. 140
  141. 141
  142. 142
  143. 143
  144. 144
  145. 145
  146. 146
  147. 147
  148. 148
  149. 149
  150. 150
  151. 151
  152. 152
  153. 153
  154. 154
  155. 155
  156. 156
  157. 157
  158. 158
  159. 159
  160. 160
  161. 161
  162. 162
  163. 163
  164. 164
  165. 165
  166. 166
  167. 167
  168. 168
  169. 169
  170. 170
  171. 171
  172. 172
  173. 173
  174. 174
  175. 175
  176. 176
  177. 177
  178. 178
  179. 179
  180. 180
  181. 181
  182. 182
  183. 183
  184. 184
  185. 185
  186. 186
  187. 187
  188. 188
  189. 189
  190. 190
  191. 191
  192. 192
  193. 193
  194. 194
  195. 195
  196. 196
  197. 197
  198. 198
  199. 199
  200. 200
  201. 201
  202. 202
  203. 203
  204. 204
  205. 205
  206. 206
  207. 207
  208. 208
  209. 209
  210. 210
  211. 211
  212. 212
  213. 213
  214. 214
  215. 215
  216. 216
  217. 217
  218. 218
  219. 219
  220. 220
  221. 221
  222. 222
  223. 223
  224. 224
  225. 225
  226. 226
  227. 227
  228. 228
  229. 229
  230. 230
  231. 231
  232. 232
  233. 233
  234. 234
  235. 235
  236. 236
  237. 237
  238. 238
  239. 239
  240. 240
  241. 241
  242. 242
  243. 243
  244. 244
  245. 245
  246. 246
  247. 247
  248. 248
  249. 249
  250. 250
  251. 251
  252. 252
  253. 253
  254. 254
  255. 255
  256. 256
  257. 257
  258. 258
  259. 259
  260. 260
  261. 261
  262. 262
  263. 263
  264. 264
  265. 265
  266. 266
  267. 267
  268. 268
  269. 269
  270. 270
  271. 271
  272. 272
  273. 273
  274. 274
  275. 275
  276. 276
  277. 277
  278. 278
  279. 279
  280. 280
  281. 281
  282. 282
  283. 283
  284. 284
  285. 285
  286. 286
  287. 287
  288. 288
  289. 289
  290. 290
  291. 291
  292. 292
  293. 293
  294. 294
  295. 295
  296. 296
  297. 297
  298. 298
  299. 299
  300. 300
  301. 301
  302. 302
  303. 303
  304. 304
  305. 305
  306. 306
  307. 307
  308. 308
  309. 309
  310. 310
  311. 311
  312. 312
  313. 313
  314. 314
  315. 315
  316. 316
  317. 317
  318. 318
  319. 319
  320. 320
  321. 321
  322. 322
  323. 323
  324. 324
  325. 325
  326. 326
  327. 327
  328. 328
  329. 329
  330. 330
  331. 331
  332. 332
  333. 333
  334. 334
  335. 335
  336. 336
  337. 337
  338. 338
  339. 339
  340. 340
  341. 341
  342. 342
  343. 343
  344. 344
  345. 345
  346. 346
  347. 347
  348. 348
  349. 349
  350. 350
  351. 351
  352. 352
  353. 353
  354. 354
  355. 355
  356. 356
  357. 357
  358. 358
  359. 359
  360. 360
  361. 361
  362. 362
  363. 363
  364. 364
  365. 365
  366. 366
  367. 367
  368. 368
  369. 369
  370. 370
  371. 371
  372. 372
  373. 373
  374. 374
  375. 375
  376. 376
  377. 377
  378. 378
  379. 379
  380. 380
  381. 381
  382. 382
  383. 383
  384. 384
  385. 385
  386. 386
  387. 387
  388. 388
  389. 389
  390. 390
  391. 391
  392. 392
  393. 393
  394. 394
  395. 395
  396. 396
  397. 397
  398. 398
  399. 399
  400. 400
  401. 401
  402. 402
  403. 403
  404. 404
  405. 405
  406. 406
  407. 407
  408. 408
  409. 409
  410. 410
  411. 411
  412. 412
  413. 413
  414. 414
  415. 415
  416. 416
  417. 417
  418. 418
  419. 419
  420. 420
  421. 421
  422. 422
  423. 423
  424. 424
  425. 425
  426. 426
  427. 427
  428. 428
  429. 429
  430. 430
  431. 431
  432. 432
  433. 433
  434. 434
  435. 435
  436. 436
  437. 437
  438. 438
  439. 439
  440. 440
  441. 441
  442. 442
  443. 443
  444. 444
  445. 445
  446. 446
  447. 447
  448. 448
  449. 449
  450. 450
  451. 451
  452. 452
  453. 453
  454. 454
  455. 455
  456. 456
  457. 457
  458. 458
  459. 459
  460. 460
  461. 461
  462. 462
  463. 463
  464. 464
  465. 465
  466. 466
  467. 467
  468. 468
  469. 469
  470. 470
  471. 471
  472. 472
  473. 473
  474. 474
  475. 475
  476. 476
  477. 477
  478. 478
  479. 479
  480. 480
  481. 481
  482. 482
  483. 483
  484. 484
  485. 485
  486. 486
  487. 487
  488. 488
  489. 489
  490. 490
  491. 491
  492. 492
  493. 493
  494. 494
  495. 495
  496. 496
  497. 497
  498. 498
  499. 499
  500. 500
  501. 501
  502. 502
  503. 503
  504. 504
  505. 505
  506. 506
  507. 507
  508. 508
  509. 509
  510. 510
  511. 511
  512. 512
  513. 513
  514. 514
  515. 515
  516. 516
  517. 517
  518. 518
  519. 519
  520. 520
  521. 521
  522. 522
  523. 523
  524. 524
  525. 525
  526. 526
  527. 527
  528. 528
  529. 529
  530. 530
  531. 531
  532. 532
  533. 533
  534. 534
  535. 535
  536. 536
  537. 537
  538. 538
  539. 539
  540. 540
  541. 541
  542. 542
  543. 543
  544. 544
  545. 545
  546. 546
  547. 547
  548. 548
  549. 549
  550. 550
  551. 551
  552. 552
  553. 553
  554. 554
  555. 555
  556. 556
  557. 557
  558. 558
  559. 559
  560. 560
  561. 561
  562. 562
  563. 563
  564. 564
  565. 565
  566. 566
  567. 567
  568. 568
  569. 569
  570. 570
  571. 571
  572. 572
  573. 573
  574. 574
  575. 575
  576. 576
  577. 577
  578. 578
  579. 579
  580. 580
  581. 581
  582. 582
  583. 583
  584. 584
  585. 585
  586. 586
  587. 587
  588. 588
  589. 589
  590. 590
  591. 591
  592. 592
  593. 593
  594. 594
  595. 595
  596. 596
  597. 597
  598. 598
  599. 599
  600. 600
  601. 601
  602. 602
  603. 603
  604. 604
  605. 605
  606. 606
  607. 607
  608. 608
  609. 609
  610. 610
  611. 611
  612. 612
  613. 613
  614. 614
  615. 615
  616. 616
  617. 617
  618. 618
  619. 619
  620. 620
  621. 621
  622. 622
  623. 623
  624. 624
  625. 625
  626. 626
  627. 627
  628. 628
  629. 629
  630. 630
  631. 631
  632. 632
  633. 633
  634. 634
  635. 635
  636. 636
  637. 637
  638. 638
  639. 639
  640. 640
  641. 641
  642. 642
  643. 643
  644. 644
  645. 645
  646. 646
  647. 647
  648. 648
  649. 649
  650. 650
  651. 651
  652. 652
  653. 653
  654. 654
  655. 655
  656. 656
  657. 657
  658. 658
  659. 659
  660. 660
  661. 661
  662. 662
  663. 663
  664. 664
  665. 665
  666. 666
  667. 667
  668. 668
  669. 669
  670. 670
  671. 671
  672. 672
  673. 673
  674. 674
  675. 675
  676. 676
  677. 677
  678. 678
  679. 679
  680. 680
  681. 681
  682. 682
  683. 683
  684. 684
  685. 685
  686. 686
  687. 687
  688. 688
  689. 689
  690. 690
  691. 691
  692. 692
  693. 693
  694. 694
  695. 695
  696. 696
  697. 697
  698. 698
  699. 699
  700. 700
  701. 701
  702. 702
  703. 703
  704. 704
  705. 705
  706. 706
  707. 707
  708. 708
  709. 709
  710. 710
  711. 711
  712. 712
  713. 713
  714. 714
  715. 715
  716. 716
  717. 717
  718. 718
  719. 719
  720. 720
  721. 721
  722. 722
  723. 723
  724. 724
  725. 725
  726. 726
  727. 727
  728. 728
  729. 729
  730. 730
  731. 731
  732. 732
  733. 733
  734. 734
  735. 735
  736. 736
  737. 737
  738. 738
  739. 739
  740. 740
  741. 741
  742. 742
  743. 743
  744. 744
  745. 745
  746. 746
  747. 747
  748. 748
  749. 749
  750. 750
  751. 751
  752. 752
  753. 753
  754. 754
  755. 755
  756. 756
  757. 757
  758. 758
  759. 759
  760. 760
  761. 761
  762. 762
  763. 763
  764. 764
  765. 765
  766. 766
  767. 767
  768. 768
  769. 769
  770. 770
  771. 771
  772. 772
  773. 773
  774. 774
  775. 775
  776. 776
  777. 777
  778. 778
  779. 779
  780. 780
  781. 781
  782. 782
  783. 783
  784. 784
  785. 785
  786. 786
  787. 787
  788. 788
  789. 789
  790. 790
  791. 791
  792. 792
  793. 793
  794. 794
  795. 795
  796. 796
  797. 797
  798. 798
  799. 799
  800. 800
  801. 801
  802. 802
  803. 803
  804. 804
  805. 805
  806. 806
  807. 807
  808. 808
  809. 809
  810. 810
  811. 811
  812. 812
  813. 813
  814. 814
  815. 815
  816. 816
  817. 817
  818. 818
  819. 819
  820. 820
  821. 821
  822. 822
  823. 823
  824. 824
  825. 825
  826. 826
  827. 827
  828. 828
  829. 829
  830. 830
  831. 831
  832. 832
  833. 833
  834. 834
  835. 835
  836. 836
  837. 837
  838. 838
  839. 839
  840. 840
  841. 841
  842. 842
  843. 843
  844. 844
  845. 845
  846. 846
  847. 847
  848. 848
  849. 849
  850. 850
  851. 851
  852. 852
  853. 853
  854. 854
  855. 855
  856. 856
  857. 857
  858. 858
  859. 859
  860. 860
  861. 861
  862. 862
  863. 863
  864. 864
  865. 865
  866. 866
  867. 867
  868. 868
  869. 869
  870. 870
  871. 871
  872. 872
  873. 873
  874. 874
  875. 875
  876. 876
  877. 877
  878. 878
  879. 879
  880. 880
  881. 881
  882. 882
  883. 883
  884. 884
  885. 885
  886. 886
  887. 887
  888. 888
  889. 889
  890. 890
  891. 891
  892. 892
  893. 893
  894. 894
  895. 895
  896. 896
  897. 897
  898. 898
  899. 899
  900. 900
  901. 901
  902. 902
  903. 903
  904. 904
  905. 905
  906. 906
  907. 907
  908. 908
  909. 909
  910. 910
  911. 911
  912. 912
  913. 913
  914. 914
  915. 915
  916. 916
  917. 917
  918. 918
  919. 919
  920. 920
  921. 921
  922. 922
  923. 923
  924. 924
  925. 925
  926. 926
  927. 927
  928. 928
  929. 929
  930. 930
  931. 931
  932. 932
  933. 933
  934. 934