1. Math

    I have a couple questions about the sums of geometric series. One. So the formula for the sum is t(n)=t(1)[(r^n)-1] But if my series starts at t(0), can I change the formula to t(n)=t(0)[(r^n)-1] ? Two. If, in the series, there is a different pattern in

    asked by Anonymous on October 31, 2010
  2. statistics

    A sixth form class consists of 6 girls and 9 boys. Three students from the class are chosen at random. The number of boys chosen is denoted by the random variable X. Show that a)P(X=0)=120/2730 b)P(X=2)=1296/2730

    asked by Nabiha on December 3, 2011
  3. Geometry

    A sample of a plane geometric surface is the A. surface of a sphere. B. side of a cylinder. C. side of a box. D. side of a cone. I'm stuck on this simple but tricky question. I'm leaning toward A or C.

    asked by Anonymous on June 10, 2015
  4. math

    Hi. I'm having trouble with the summation of n from i=2 of ((2^n-i)(2^n)). Any help would be greatly appreciated! the way I am reading the question you have i is going from 2 to n so there will be n-1 terms using i = 2,3,4,..,n I get 2^(2n-2) + 2^(2n-2) +

    asked by relle on April 24, 2007
  5. math

    List the terms that complete a possible pattern in each of the following and state whether the pattern is arithmetic, geometric, or neither: (a) 38, 33, 28, 23, 18, … (b) 640, 320, 160, 80, … (e) 1, ___, ___, ___ 25, 36, 49

    asked by judy on July 14, 2011
  6. arithmetic

    List the terms that complete a possible pattern in each of the following and state whether the pattern is arithmetic, geometric, or neither: (a) 38, 33, 28, 23, 18, … (b) 640, 320, 160, 80, … (e) 1, ___, ___, ___ 25, 36, 49

    asked by judy on July 13, 2011
  7. Social Impact of Technology

    VEhrlich’s dire projections differed from those of Malthus in that he applied the principle of geometric progression to: A. vital resources such as oil, copper, and top soils. B. significant climate change variables. C. increasing species die-off. D. the

    asked by Angela on December 21, 2016
  8. algerbra

    who invented algerbra and why is it important I searched on the internet and found notations as far back as 1850 BC (that's a long time ago) by a plethora of nations (Egypt, India, and others). Your next question is easier to answer. MOST of the work

    asked by helen on September 19, 2006
  9. math

    the fourth terms of an AP is 37 and the 6th terms is 12 more than the fourth term.Find the first and seventh terms.

    asked by Dallas on April 21, 2015
  10. math

    The sum of 18 terms of an A.P is 504 while the sum of its 9 terms is -126.Find the sum of its 30 term

    asked by precious on November 20, 2018
  11. Science

    This is a normal nucleotide sequence found on a section of DNA: A-A-T-A-G-C-A-T-T What is a small-scale mutation caused by deletion? A) A-A-T-A-C-A-T-T B) A-A-T-A-G-C-A-T-A C) A-A-T-A-C-G-A-T-A D) A-A-U-A-G-C-A-U I think the answer is a!

    asked by I am 13 on April 29, 2018
  12. Math

    make a conjecture (obsevations based on patterns) for each sequence below. a)7,10,13,16 b)4,44,444,4444,44444 c)2,10,50,250 d)1,2,6,42,1806,3263442

    asked by Kale on December 16, 2010
  13. Math

    The sequence < un > is defined by the recurrence Un+1 = 3Un+1\5Un+3 initial condition of u1 = 1: Need to show un in terms of Fibonacci / Lucas numbers

    asked by Kate on November 16, 2016
  14. Fibonacci Sequence

    The sequence < un > is defined by the recurrence Un+1 = 3Un+1\5Un+3 initial condition of u1 = 1: Need to show un in terms of Fibonacci / Lucas numbers

    asked by Kate on November 16, 2016
  15. geometry

    19 or 20. Describe the sequence of transformations from quadrilateral ABCD to A’B’C’D’. The graph is 10 by 10 (the x and y coordinates go to 10 and negative 10 at maximum). A is at -8,8 B is at -2,8, C is at -8,4 and D is at -2,4. A' is at 2,-10 B'

    asked by Anon on January 22, 2019
  16. Math

    make a conjecture (obsevations based on patterns) for each sequence below. a)7,10,13,16 b)4,44,444,4444,44444 c)2,10,50,250 d)1,2,6,42,1806,3263442

    asked by walter on December 17, 2010
  17. COM321: Communication Theory

    Sue has given campus tours to prospective students for so long that she knows exactly what to do next. Her knowledge of the sequence of actions involved in giving a tour is

    asked by Marie on December 2, 2013
  18. Biology

    What amino acid property makes proteins highly functional? I would assume it would be the structure and sequence, but are there additional properties?

    asked by Aaron on February 23, 2017
  19. math

    When finding the sum of the arithmetic sequence 4 + 1 + –2 + –5 + –8 + –11, you will have a step of work that contains the number –3. Use complete sentences to describe how the –3 was calculated and what it means.

    asked by matt on April 2, 2011
  20. Maths

    A sequence {ai}is defined by the recurrence relation an=40−4an−1 with a0=−4. There exists real valued constants r,s and t such that ai=r⋅si+t for all non-negative integers i. Determine r2+s2+t2.

    asked by Abhishek Ranjan on June 30, 2013
  21. Math

    Good day please help.Iam struggling with number patterns,i must fid the rule and also give the nextthree numbers in the sequence. 31;30;27,22;15

    asked by Aiden on July 22, 2014
  22. biology

    Can someone please check this defintion. What else can I put? Mutation=change to the base pair sequence of the genetic material of an organism What is 'Heredity'?

    asked by Anonymous on January 15, 2008
  23. Foreign languages

    Writeacher, could you please check these sentences? Thank you. 1) Who was Henrietta Lacks? In what way did she contribute to the study of cancer? 2) Is it possible to stop the aging process? How did Lord Henry define beauty and old age respectively? 3) Who

    asked by Mike on June 25, 2012
  24. Chemistry

    Which of the statements correctly describes the main reason why the long-term storage of high-level nuclear waste is considered to be high-risk? A. High-level nuclear waste generates a lot of heat and poses a threat to life while it remains at high

    asked by Michael on June 13, 2018
  25. Algebra

    Find all positive values for k for which each of the following can be factored. X^2-x-k (Your answer seems to be the same as the other problem x^2+x-k ) Is this correct too? Consider your equation to be in the form ax^2 + bx = c = 0. It can be factored

    asked by Scott on July 23, 2007
  26. algerbra

    Find the GCF of each product. (2x2+5x)(7x - 14) (6y2 -3y)( y+7) When the term "Greatest Common Factor" is used, it applies to a pair of numbers. The terms you have liated are polynomials that have already been factored. They could be further factored into

    asked by Susie on July 2, 2007
  27. sun ridge

    as a diver descends below the surface of the ocean, she attaches air tanks to a long cable. the first tank is at 150 meters below the surface. the other tanks are attached at intervals of 250 meters below the surface. what integer represents the depth

    asked by nathab on August 20, 2012
  28. Physics

    In a supermarket parking lot, an employee is pushing ten empty shopping carts, lined up in a straight line. The acceleration of the carts is 0.080 m/s2. The ground is level, and each cart has a mass of 25 kg. (a) What is the net force acting on any one of

    asked by NHS on September 17, 2007
  29. math

    A ball dropped 16 feet. The height of each bounce of the ball is 8 feet, 4 feet, 2 feet and so on. How high will the sixth bounce be show all of your work

    asked by lee on February 12, 2013
  30. Math - algebraish

    hey how do we convert y=mx+b to standard form? the standard form of the equation of a straight line is usually considered to take this form Ax + By = C, where A,B, and C are integers and A is positive. So if your equation is in the slope-yintercept form

    asked by gorden on April 9, 2007
  31. division of fractions

    Division of fractions is sometimes said to be multiplication of inverses. Elaborate with an explanation and example. If you have a/b divided by c/d this is the same as a/b * d/c If e.g., we have 2/3 divided by 7/9 then we have 2/3 * 9/7 = 6/7 When dividing

    asked by Brenda on October 7, 2006
  32. Science/Math

    John and Al are in a 15 km race. John averages 4.4 m/s during the first half of the race and then runs at a speed of 4.2 m/s until the last 200 m, which he covers at 4.5 m/s. At what average speed must Al run to beat John? The textbook that included the

    asked by Walter on September 30, 2013
  33. Math

    Gravity on the moon is about one-sixth of gravity on Earth. An astronaut standing on a tower 20 feet above the moon's surface throws a ball upward with a velocity of 30 feet per second. The height of the ball at any time t (in seconds) is h(t) = -2.67t

    asked by Anonymous on October 14, 2010
  34. US history

    The supreme court under chief justice John Marshall was similar to the court under chief justice Earl Warren in that both 1) strengthened the power and influence of business 2) increased the president's war powers 3) changed public policy through broad

    asked by Anonymous on May 16, 2011
  35. accounting

    Ed O'Connor Associates reported short-termed notes payable as follows: 2012 2011 current liabilities (partial) short-term n/p $16,700 $15,500 salary payable 3,800 3,200 During 2012 O'Connor paid off both current liabilities that were left over from 2011.

    asked by marie on February 9, 2010
  36. Math

    The Garraty company has two bond issues outstanding. Both bonds pa $100 annual interest plus $1,000 at maturity. Bond L has a maturity of 15 years and Bond S a maturity of 1 year. A). What will be the value of each of these bonds when the going rate of

    asked by Dee Dee on June 17, 2006
  37. math

    A quadratic function has its vertex at the point (-9,3). The function passes through the point (2,-1). Find the quadratic and linear coefficients and the constant term of the function.

    asked by Anonymous on November 20, 2009
  38. Pre-Calc

    A quadratic function has its vertex at the point (-5,-2). The function passes through the point (-8,-10). Find the quadratic and linear coefficients and the constant term of the function.

    asked by Caleb on September 24, 2014
  39. Gr. 12 Data Management

    In playing poker, the likelihood of being dealt a particular hand depends on the number of ways in which that hand could have been dealt from the 52-card deck. Find the number of ways each hand could be dealt. a) No pairs (five different face values, not

    asked by avm on October 18, 2009
  40. Algebra II

    Help me with this, please... A ball is dropped vertically from a height of 80 meters. After each bounce, the ball reaches a maximum height equal to 60 percent of maximum height of the previous bounce. a. Write the first three terms of the sequence. Explain

    asked by Me and I on April 10, 2014
  41. Biology help..!

    How does the nucleotide sequence in one chain of DNA compare with the other chain of DNA? The are complementary. How does the nucleotide sequence in one chain of DNA compare with the other chain of DNA?

    asked by Becky on January 9, 2007
  42. English

    I urgently need you to check this summary I wrote on "fiction". I'm sending it into two separate posts. Thank you very much, writeacher!! 1) The setting is the time and place in which the action of a book happens. The setting can reveal a great deal about

    asked by Henry2 on February 20, 2012
  43. math

    what is the proper name for a 5 pointed star with reference to a geometric name? pentagram the proper name for it would be pentagram!

    asked by nicole on December 13, 2006
  44. math

    Q: Corbin is playing a board game that requires rolling two number cubes to move a game piece. He needs to roll a sum of six on his next term and then a sum of ten to land on to the next two bonus spaces. what is the probability that Corbin will roll a sum

    asked by dingbat on March 9, 2013
  45. Algebra 2

    The mass of the particles that a river can transport is proportional to the sixth power of the speed of the river. A certain river normally flows at a speed of 2 miles per hour. What must its speed be in order to transport particles that are 15 times as

    asked by Philip on December 11, 2016
  46. precalculus

    can you check my answer? Find the coefficient of the term a6b3 in the binomial expansion of the expression (a - 4b)9. ________________________________________ 5,376 344,064 -5,376 -344,064 answer: b

    asked by sally on December 16, 2016
  47. algebra

    2a+3b-4c=7, a-b+2c=6 a) find an ordered triple of numbers (a,b,c) that satisfies both equations b) can you find a second ordered triple that satisfies both equations c) solve for b in terms of a, and solve for c in terms of a. how many solutions does this

    asked by Anonymous on August 2, 2019
  48. algebra

    The 2842-seat performing arts center has three sections-orchestra, mezzanine, and balcony. The mezzanine has one-sixth fewer seats than the orchestra. How many seats are in the balcony if the orchestra has 1,218 seats? Please show me how to set up the

    asked by Mark on April 15, 2008
  49. math,(fraction)

    Susan had some money. she spent one-sixth of her money on Saturday.on Sunday,she spent one-half of the remaining money and gave $20 to her niece. she spent the rest of her money at an average of $15 for the next 5days.how much money did Susan have at

    asked by Da S on December 27, 2011
  50. algebra 2

    The mass of the particles that a river can transport is proportional to the sixth power of the speed of the river. A certain river normally flows at a speed of 3 miles per hour. What must its speed be in order to transport particles that are 200 times as

    asked by John on February 5, 2018
  51. Math

    Term-structure of interest rates and Arbitrage The current term-structure of spot interest rates for safe zero-coupon bonds is as follows: Maturity, in years Interest rate (r) 1 8% 2 10% 3 11% 4 12% 5 13% There is a safe bond B which has 4 years before

    asked by Robbie on December 3, 2011
  52. Math

    What is the mathematical term for a statement that can be flipped and still remain true? Example: A cat is a feline, and a feline is a cat. AND/OR What is the mathematical term for a statement that becomes false when flipped? Example: A square is a

    asked by Christina on January 30, 2011
  53. Business English

    Identify and correct the errors in the following to create parallel structure: To narrow a web search a. Put quotation marks around a phrase when you want an exact term. b. Many search engines have wild cards (usually an asterisk) to find plurals and other

    asked by Nate on January 18, 2015
  54. History

    "The time for the new election of a citizen to be president of the United States is coming soon. I should now tell you of my decision: I will not be among the candidates considered for the position." Read the paraphrase of a text written by George

    asked by Laney on November 6, 2016
  55. SS help fast

    Why did Muslims maintain taboo against idol? A)Because the commandments Ban worship of idols**** B)Because Jews & Christians Do not Portray Idols C)Because they prefer geometric art forms D) because Muslims do not have the skill to make Idols

    asked by Harley on February 1, 2018
  56. algebra

    Find all positive values for k for which each of the following can be factored. x^2+3x+kthe coefficent of the middle term is 3 3=2+1 k=2*1=2 did i do this right This one I had no Idea where to start can some one please explain it to me x^2+x-k The second

    asked by allen on May 9, 2007
  57. social studies

    1) What is one certain long-term cost of adding to the national debt? a. american's in the future must have fewer public services b. american's in the future with not vote in elections c. american's in the future will not enjoy the benefits of the program

    asked by Catalena on January 27, 2015
  58. History

    What is one certain long-term cost of adding to national debt? a.) Americans in the future must have fewer public services b.) Americans in the future will not vote in elections c.) Americans in the future will not enjoy the benefits of the program d.)

    asked by Shane on April 30, 2015
  59. SS

    What is one certain long-term cost of adding to the national debt? Americans in the future must have fewer public services. Americans in the future will not vote in elections. Americans in the future will not enjoy the benefits of the program. Americans in

    asked by Anonymous on February 5, 2014
  60. real estate finance

    Jay has an annual income of $50,000. He would qualify for a $__________ monthly payment for housing + other long-term debt on an FHA loan. I have the GMI, but I'm not sure as to how to find the monthly payment. Do I multiply the GMI by 28% in order to get

    asked by tmouery on April 20, 2013
  61. Chemistry

    What does ammonia have anything to do with bogdan's rocket building? -can't find this anywhere if we had to order ammonia we don't order in pure. it is ordered in clandestine, liquid solution. the ammonia exists in this aq solution in eq. what is the eq

    asked by Xi on October 27, 2008
  62. Chemistry

    What does ammonia have anything to do with bogdan's rocket building? -can't find this anywhere if we had to order ammonia we don't order in pure. it is ordered in clandestine, liquid solution. the ammonia exists in this aq solution in eq. what is the eq

    asked by Xi on October 27, 2008
  63. geometry

    A pentagon is a geometric figure with 5 sides. The lengths of the sides of a given pentagon are (6x + 2) cm, (3x + 2) cm, (2x) cm,(3x + 4) cm, and (8x – 4) cm. Which equation below describes the perimeter, P, of the pentagon in terms of x?

    asked by Anonymous on April 6, 2011
  64. math

    sorry for before it is my first time using this website and this is the real question in a geometric series t1=23,t3=92 and the sum of all of the terms of the series is 62813. How many terms are in the series?

    asked by Bob on June 3, 2013
  65. a.p.

    the sum of four terms of an a.p. is 4 and the sum of product of first and last term and product of middle terms in -38, then find the numbes.

    asked by warnar on December 12, 2016
  66. Eng1511

    Summarize the sequence of events leading to the write's proposal to mimmy.highlight the details of the couple's journey to finding love

    asked by Nqobile on February 26, 2013
  67. Algebra

    What are the next three terms in the sequence? -3 6 15 24 Geoff planted dahlias in his garden... please help with Lesson 13 Functions Unit Test Algebra for Connections Academy!

    asked by Loki on February 14, 2018
  68. Genetics

    1) Do you know if the nucleotide sequence of a mutation tell you anything about its dominance or recessiveness? 2) Do you know the role that Ras play in the signal transduction pathway that makes it an oncogene?

    asked by Bobby on November 4, 2011
  69. English

    What is the best strategy for organizing an essay to describe events in time sequence? A)comparison and contrast B)order of importance C)chronological D)spatial

    asked by Mike on April 3, 2014
  70. physics

    The average car today has a mass of 1100 kg, and when accelerating from rest, covers 0.25 miles in 15 seconds. Each rim and tire together has a diameter of 46 cm and a mass of 9.1kg. If we agree the rim and tire have the shape of a solid disk that rotates

    asked by Anonymous on November 3, 2014
  71. physics

    The average car today has a mass of 1100 kg, and when accelerating from rest, covers 0.25 miles in 15 seconds. Each rim and tire together has a diameter of 46 cm and a mass of 9.1kg. If we agree the rim and tire have the shape of a solid disk that rotates

    asked by san on November 3, 2014
  72. ALGEBRA

    Find all positive values for k for which each of the following can be factored. I have 2 problems i think i got the one right but not sure the second one i have no idea where to even start 2x^3+16x^2-40x=2x(x^2+8x-20) (x-2)(x+10)=8x this one i am stumped

    asked by TAMMY on April 25, 2007
  73. Math

    Find the limit of the sequence 2ln(1+3n) - ln(4+n^2) What I did: lim as n approach inf of an = 2*lim ln (1+3n)/(4+n^2) = 2 * lim ln (1/n^2 + 3n/n^2) / (4/n^2 + n^2/n^2) = 2 * lim ln (1/n^2 + 3/n) / (4/n^2 + 1) = 2 * lim ln (1/inf^2 + 3/inf) / (4/inf^2 +1)

    asked by Helloo on April 25, 2019
  74. Science

    1.)When evaluation was first processed which of the following was used as evidence to suport the idea (1 point) a.)observations of nature**** b.)laboratory experiments c.)extensive fossil collections b.)genetic sequence 2.)a farmer sprays insecticide on

    asked by Hannah on October 2, 2014
  75. BIO 12

    BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A

    asked by Stephanie on September 24, 2015
  76. math

    The number uses every number 0-9 the numbers are used only once the fourth digit is 4 the first digit in the billions place is 3 the 5 is next to the last digit the sixth digit is 7 the digit after 3 is 9 the digit before 5 is 2the third digit is half the

    asked by Anonymous on October 20, 2011
  77. algebra

    1.)correct 2.)wrong---> the first term is wrong 4(3a^2)^2 = 36a^4 3.) not sure on this one 4.) wrong---> - square root of six is not a solution Hope this Helps! 1)find p(-3)if p(x)=4x^3-5x^2+7x-10 =-184 2)If r(x)=4x^2-3x+7,find r(3a^2) =12a^4-9a^2+7

    asked by manny on August 16, 2007
  78. Physics

    A child is playing with a remote-controlled racecar on the fire escape of a sixth-floor apartment. An accidental turn sends the car through the railing and over the edge of the fire escape. Explain why the time it takes for the car to fall does not depend

    asked by Wei on December 11, 2016
  79. Psychology

    Brief summary and example of these Cognitive Learning Strategies/types please? I don't have my book yet and I need these ASAP!!!!! Ex: Three-stage information processing model is which includes a short definition or description of (a) sensory-register, (b)

    asked by Williams on May 25, 2014
  80. Maths

    In a box of chocolates, •one-fifth are plain chocolate •one-sixth are white chocolate •the other 38 are milk chocolate. How many chocolates are there in the box?

    asked by Amy on July 16, 2016
  81. algebra

    you have a mean score of 84 after taking 5 100 point tests. What do you need to score on the sixth 100-point test to have a mean score of 85?

    asked by malik on October 2, 2008
  82. Physics

    In the Biomedical and Physical Sciences building at MSU there are 135 steps from the ground floor to the sixth floor. Each step is 16.0 cm tall. It takes 5 minutes and 40 seconds for a person with a mass of 63.9 kg to walk all the way up. How much work did

    asked by Kevin on April 19, 2016
  83. Physics

    In the Biomedical and Physical Sciences building at MSU there are 135 steps from the ground floor to the sixth floor. Each step is 16.0 cm tall. It takes 5 minutes and 40 seconds for a person with a mass of 63.9 kg to walk all the way up. How much work did

    asked by Kevin on April 19, 2016
  84. Math

    Help, I can't find the pattern rule for this sequence(eg. -6,-3,2,9,18 and the pattern rule is n squared-7) The pattern: 6,28,64,114,178. What's the pattern rule? The pattern: 96,84,64,36. What's the pattern rule? The pattern: 0,24,216,960. What's the

    asked by Abigail on November 2, 2011
  85. Math

    If you run 3 miles everyday for 5 days, how many miles will you need to run on the sixth day in order to have run an average of 4 miles per day over 6 days? Solve this problem in two different ways, and explain your solutions.

    asked by Miles on April 5, 2017
  86. algebra

    Okay, how do you factor a polynomial when there is a number in front of the highest x term. For example: how would you factor 2x^2-11x+15 i know the answer is (2x-5)(x-3), right? So you put the 2x on one side and then you put an x on the other. And then

    asked by Fidelia on May 15, 2007
  87. problem solving

    What rectangular regions could be enclosed? Areas? Organize a table? Make a graph? Which rectangular region has the most area? from a table? from a graph? from algebra, using the arithmetic mean-geometric mean inequality?

    asked by kakak on December 8, 2014
  88. math

    1. A die is tossed 10 times and the number of sixes rolled is recorded. The number of sixes rolled will follow what type of distribution? a. poison b. binomial c. geometric d. normal

    asked by kenneth on January 4, 2011
  89. math

    86, 64, 24...What is the next term?

    asked by sheyrl on September 12, 2010
  90. Algebra 2

    What is the third term of (x^2 + 3y)^3

    asked by Lan Zhan on July 29, 2019
  91. Math

    The 8 term of a g.p is 7/32

    asked by Tracy on November 11, 2018
  92. maths

    the sum of the 4th and 6th terms of an A.P is 42. the sum of the 3rd and 9th terms of the progression is 52. find the first term, the common difference and the sum of the first ten terms of the progression.

    asked by festus on March 7, 2012
  93. Urgent! Help please!

    On January 5, Ebony Davis borrowed $6,500 on a simple interest loan from a lending institution to finance her catering business. She borrows the money at a rate of 8.5% with a term ending on December 9. a. Calculate Ebony's interest on the simple interest

    asked by Jennifer on June 20, 2014
  94. Survey of Mathematics

    On January 5, Ebony Davis borrowed $6,500 on a simple interest loan from a lending institution to finance her catering business. She borrows the money at a rate of 8.5% with a term ending on December 9. a. Calculate Ebony's interest on the simple interest

    asked by Jennifer on June 22, 2014
  95. Survey of mathematics

    On January 5, Ebony Davis borrowed $6,500 on a simple interest loan from a lending institution to finance her catering business. She borrows the money at a rate of 8.5% with a term ending on December 9. a. Calculate Ebony's interest on the simple interest

    asked by Jennifer on June 20, 2014
  96. alberbra

    The parliament of the land of Archronia consists of two houses. The Parliament was elected in 1995 for a period of four years beginning on Monday, January 1st, 1996, when the two houses had their first sessions. According to the rules, the meetings of the

    asked by Alex on July 27, 2008
  97. math

    Again, I already know this answer... It's 12 but I do not know how to come up with this answer. Plz show me step by step how to come up with the correct answer. My test is tomorrow. Thank you in advance!! A basketball player averaged 20 points a game over

    asked by cindi on February 10, 2015
  98. Math

    Ama, Karla and Daniel are siblings. Ama is 3 years older than Karla and Daniel is 2 years older than Ama.The sum of their ages is 32. How old is each child. Please help me I don't know what to do, it's my High School Summer Holiday Homework!!! But I'm

    asked by Laiba on June 25, 2016
  99. Algebra

    Is there a shortcut to foiling an equation? I always thought that FOIL WAS a shortcut. I've never heard of "foil" before :) FOIL (First Inner Outer Last) Does this just specify an order in which you are supposed to multiply? I think the order is

    asked by jennifer on December 21, 2006
  100. math

    Write an explicit formula for the sequence one-half, three-sevenths, one-third, five-nineteenths, three-fourteenths, ... Then find a14. (1 point) an = an – 1 – n minus one over seven n; fifteeen over one hundred nintey nine an = a sub n plus one over n

    asked by paige on February 26, 2013

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92
  93. 93
  94. 94
  95. 95
  96. 96
  97. 97
  98. 98
  99. 99
  100. 100
  101. 101
  102. 102
  103. 103
  104. 104
  105. 105
  106. 106
  107. 107
  108. 108
  109. 109
  110. 110
  111. 111
  112. 112
  113. 113
  114. 114
  115. 115
  116. 116
  117. 117
  118. 118
  119. 119
  120. 120
  121. 121
  122. 122
  123. 123
  124. 124
  125. 125
  126. 126
  127. 127
  128. 128
  129. 129
  130. 130
  131. 131
  132. 132
  133. 133
  134. 134
  135. 135
  136. 136
  137. 137
  138. 138
  139. 139
  140. 140
  141. 141
  142. 142
  143. 143
  144. 144
  145. 145
  146. 146
  147. 147
  148. 148
  149. 149
  150. 150
  151. 151
  152. 152
  153. 153
  154. 154
  155. 155
  156. 156
  157. 157
  158. 158
  159. 159
  160. 160
  161. 161
  162. 162
  163. 163
  164. 164
  165. 165
  166. 166
  167. 167
  168. 168
  169. 169
  170. 170
  171. 171
  172. 172
  173. 173
  174. 174
  175. 175
  176. 176
  177. 177
  178. 178
  179. 179
  180. 180
  181. 181
  182. 182
  183. 183
  184. 184
  185. 185
  186. 186
  187. 187
  188. 188
  189. 189
  190. 190
  191. 191
  192. 192
  193. 193
  194. 194
  195. 195
  196. 196
  197. 197
  198. 198
  199. 199
  200. 200
  201. 201
  202. 202
  203. 203
  204. 204
  205. 205
  206. 206
  207. 207
  208. 208
  209. 209
  210. 210
  211. 211
  212. 212
  213. 213
  214. 214
  215. 215
  216. 216
  217. 217
  218. 218
  219. 219
  220. 220
  221. 221
  222. 222
  223. 223
  224. 224
  225. 225
  226. 226
  227. 227
  228. 228
  229. 229
  230. 230
  231. 231
  232. 232
  233. 233
  234. 234
  235. 235
  236. 236
  237. 237
  238. 238
  239. 239
  240. 240
  241. 241
  242. 242
  243. 243
  244. 244
  245. 245
  246. 246
  247. 247
  248. 248
  249. 249
  250. 250
  251. 251
  252. 252
  253. 253
  254. 254
  255. 255
  256. 256
  257. 257
  258. 258
  259. 259
  260. 260
  261. 261
  262. 262
  263. 263
  264. 264
  265. 265
  266. 266
  267. 267
  268. 268
  269. 269
  270. 270
  271. 271
  272. 272
  273. 273
  274. 274
  275. 275
  276. 276
  277. 277
  278. 278
  279. 279
  280. 280
  281. 281
  282. 282
  283. 283
  284. 284
  285. 285
  286. 286
  287. 287
  288. 288
  289. 289
  290. 290
  291. 291
  292. 292
  293. 293
  294. 294
  295. 295
  296. 296
  297. 297
  298. 298
  299. 299
  300. 300
  301. 301
  302. 302
  303. 303
  304. 304
  305. 305
  306. 306
  307. 307
  308. 308
  309. 309
  310. 310
  311. 311
  312. 312
  313. 313
  314. 314
  315. 315
  316. 316
  317. 317
  318. 318
  319. 319
  320. 320
  321. 321
  322. 322
  323. 323
  324. 324
  325. 325
  326. 326
  327. 327
  328. 328
  329. 329
  330. 330
  331. 331
  332. 332
  333. 333
  334. 334
  335. 335
  336. 336
  337. 337
  338. 338
  339. 339
  340. 340
  341. 341
  342. 342
  343. 343
  344. 344
  345. 345
  346. 346
  347. 347
  348. 348
  349. 349
  350. 350
  351. 351
  352. 352
  353. 353
  354. 354
  355. 355
  356. 356
  357. 357
  358. 358
  359. 359
  360. 360
  361. 361
  362. 362
  363. 363
  364. 364
  365. 365
  366. 366
  367. 367
  368. 368
  369. 369
  370. 370
  371. 371
  372. 372
  373. 373
  374. 374
  375. 375
  376. 376
  377. 377
  378. 378
  379. 379
  380. 380
  381. 381
  382. 382
  383. 383
  384. 384
  385. 385
  386. 386
  387. 387
  388. 388
  389. 389
  390. 390
  391. 391
  392. 392
  393. 393
  394. 394
  395. 395
  396. 396
  397. 397
  398. 398
  399. 399
  400. 400
  401. 401
  402. 402
  403. 403
  404. 404
  405. 405
  406. 406
  407. 407
  408. 408
  409. 409
  410. 410
  411. 411
  412. 412
  413. 413
  414. 414
  415. 415
  416. 416
  417. 417
  418. 418
  419. 419
  420. 420
  421. 421
  422. 422
  423. 423
  424. 424
  425. 425
  426. 426
  427. 427
  428. 428
  429. 429
  430. 430
  431. 431
  432. 432
  433. 433
  434. 434
  435. 435
  436. 436
  437. 437
  438. 438
  439. 439
  440. 440
  441. 441
  442. 442
  443. 443
  444. 444
  445. 445
  446. 446
  447. 447
  448. 448
  449. 449
  450. 450
  451. 451
  452. 452
  453. 453
  454. 454
  455. 455
  456. 456
  457. 457
  458. 458
  459. 459
  460. 460
  461. 461
  462. 462
  463. 463
  464. 464
  465. 465
  466. 466
  467. 467
  468. 468
  469. 469
  470. 470
  471. 471
  472. 472
  473. 473
  474. 474
  475. 475
  476. 476
  477. 477
  478. 478
  479. 479
  480. 480
  481. 481
  482. 482
  483. 483
  484. 484
  485. 485
  486. 486
  487. 487
  488. 488
  489. 489
  490. 490
  491. 491
  492. 492
  493. 493
  494. 494
  495. 495
  496. 496
  497. 497
  498. 498
  499. 499
  500. 500
  501. 501
  502. 502
  503. 503
  504. 504
  505. 505
  506. 506
  507. 507
  508. 508
  509. 509
  510. 510
  511. 511
  512. 512
  513. 513
  514. 514
  515. 515
  516. 516
  517. 517
  518. 518
  519. 519
  520. 520
  521. 521
  522. 522
  523. 523
  524. 524
  525. 525
  526. 526
  527. 527
  528. 528
  529. 529
  530. 530
  531. 531
  532. 532
  533. 533
  534. 534
  535. 535
  536. 536
  537. 537
  538. 538
  539. 539
  540. 540
  541. 541
  542. 542
  543. 543
  544. 544
  545. 545
  546. 546
  547. 547
  548. 548
  549. 549
  550. 550
  551. 551
  552. 552
  553. 553
  554. 554
  555. 555
  556. 556
  557. 557
  558. 558
  559. 559
  560. 560
  561. 561
  562. 562
  563. 563
  564. 564
  565. 565
  566. 566
  567. 567
  568. 568
  569. 569
  570. 570
  571. 571
  572. 572
  573. 573
  574. 574
  575. 575
  576. 576
  577. 577
  578. 578
  579. 579
  580. 580
  581. 581
  582. 582
  583. 583
  584. 584
  585. 585
  586. 586
  587. 587
  588. 588
  589. 589
  590. 590
  591. 591
  592. 592
  593. 593
  594. 594
  595. 595
  596. 596
  597. 597
  598. 598
  599. 599
  600. 600
  601. 601
  602. 602
  603. 603
  604. 604
  605. 605
  606. 606
  607. 607
  608. 608
  609. 609
  610. 610
  611. 611
  612. 612
  613. 613
  614. 614
  615. 615
  616. 616
  617. 617
  618. 618
  619. 619
  620. 620
  621. 621
  622. 622
  623. 623
  624. 624
  625. 625
  626. 626
  627. 627
  628. 628
  629. 629
  630. 630
  631. 631
  632. 632
  633. 633
  634. 634
  635. 635
  636. 636
  637. 637
  638. 638
  639. 639
  640. 640
  641. 641
  642. 642
  643. 643
  644. 644
  645. 645
  646. 646
  647. 647
  648. 648
  649. 649
  650. 650
  651. 651
  652. 652
  653. 653
  654. 654
  655. 655
  656. 656
  657. 657
  658. 658
  659. 659
  660. 660
  661. 661
  662. 662
  663. 663
  664. 664
  665. 665
  666. 666
  667. 667
  668. 668
  669. 669
  670. 670
  671. 671
  672. 672
  673. 673
  674. 674
  675. 675
  676. 676
  677. 677
  678. 678
  679. 679
  680. 680
  681. 681
  682. 682
  683. 683
  684. 684
  685. 685
  686. 686
  687. 687
  688. 688
  689. 689
  690. 690
  691. 691
  692. 692
  693. 693
  694. 694
  695. 695
  696. 696
  697. 697
  698. 698
  699. 699
  700. 700
  701. 701
  702. 702
  703. 703
  704. 704
  705. 705
  706. 706
  707. 707
  708. 708
  709. 709
  710. 710
  711. 711
  712. 712
  713. 713
  714. 714
  715. 715
  716. 716
  717. 717
  718. 718
  719. 719
  720. 720
  721. 721
  722. 722
  723. 723
  724. 724
  725. 725
  726. 726
  727. 727
  728. 728
  729. 729
  730. 730
  731. 731
  732. 732
  733. 733
  734. 734
  735. 735
  736. 736
  737. 737
  738. 738
  739. 739
  740. 740
  741. 741
  742. 742
  743. 743
  744. 744
  745. 745
  746. 746
  747. 747
  748. 748
  749. 749
  750. 750
  751. 751
  752. 752
  753. 753
  754. 754
  755. 755
  756. 756
  757. 757
  758. 758
  759. 759
  760. 760
  761. 761
  762. 762
  763. 763
  764. 764
  765. 765
  766. 766
  767. 767
  768. 768
  769. 769
  770. 770
  771. 771
  772. 772
  773. 773
  774. 774
  775. 775
  776. 776
  777. 777
  778. 778
  779. 779
  780. 780
  781. 781
  782. 782
  783. 783
  784. 784
  785. 785
  786. 786
  787. 787
  788. 788
  789. 789
  790. 790
  791. 791
  792. 792
  793. 793
  794. 794
  795. 795
  796. 796
  797. 797
  798. 798
  799. 799
  800. 800
  801. 801
  802. 802
  803. 803
  804. 804
  805. 805
  806. 806
  807. 807
  808. 808
  809. 809
  810. 810
  811. 811
  812. 812
  813. 813
  814. 814
  815. 815
  816. 816
  817. 817
  818. 818
  819. 819
  820. 820
  821. 821
  822. 822
  823. 823
  824. 824
  825. 825
  826. 826
  827. 827
  828. 828
  829. 829
  830. 830
  831. 831
  832. 832
  833. 833
  834. 834
  835. 835
  836. 836
  837. 837
  838. 838
  839. 839
  840. 840
  841. 841
  842. 842
  843. 843
  844. 844
  845. 845
  846. 846
  847. 847
  848. 848
  849. 849
  850. 850
  851. 851
  852. 852
  853. 853
  854. 854
  855. 855
  856. 856
  857. 857
  858. 858
  859. 859
  860. 860
  861. 861
  862. 862
  863. 863
  864. 864
  865. 865
  866. 866
  867. 867
  868. 868
  869. 869
  870. 870
  871. 871
  872. 872
  873. 873
  874. 874
  875. 875
  876. 876
  877. 877
  878. 878
  879. 879
  880. 880
  881. 881
  882. 882
  883. 883
  884. 884
  885. 885
  886. 886
  887. 887
  888. 888
  889. 889
  890. 890
  891. 891
  892. 892
  893. 893
  894. 894
  895. 895
  896. 896
  897. 897
  898. 898
  899. 899
  900. 900
  901. 901
  902. 902
  903. 903
  904. 904
  905. 905
  906. 906
  907. 907
  908. 908
  909. 909
  910. 910
  911. 911
  912. 912
  913. 913
  914. 914
  915. 915
  916. 916
  917. 917
  918. 918
  919. 919
  920. 920
  921. 921
  922. 922
  923. 923
  924. 924
  925. 925
  926. 926
  927. 927
  928. 928
  929. 929
  930. 930