science, biology

41,099 results, page 66
  1. biology

    1. Enzyme competition occurs when: A. one type of enzyme reacts with one type of substrate. B. an enzyme does not react with a substrate. C. three different types of enzymes react with one type of substrate. D. an enzyme stops a reaction. is it C 2. The
  2. Biology

    The production of a polypeptide involves the correct sequencing of amino acids, originally encoded by a segment of DNA. This code is transcribed onto mRNA and subsequently translated using tRNA. From the following DNA segment, record the base sequence that
  3. Biology

    In snapdragon plants, neither one of the petal colors is dominant to the other. The hybrids have a intermediate phenotype. If a homozygous red flower is crossed with a homozygous white flower, What will the offspring’s phenotype
  4. Biology

    There are 20 amino acids that cells use to build the numerous amounts of proteins that are essential for life. If a protein molecule consisted of 100 amino acids, how many combinations are possible? What is the probability that out of the total possible
  5. Science

    I have to do an assignment on designing an animal that has adapted to life in the waters of the dead sea. But nothing can live in the dead sea so I don't know what to do. Can anyone help with suggestions? What about a micro organism? There are bacteria
  6. Environmental Science

    What steps do you think can be taken to reduce the harmful effects of human activities on biogeochemical cycles? Which businesses would these changes impact the most? Thank you for using the Jiskha Homework Help Forum. Here are some links on life and
  7. Biology

    14. The stomata are responsible for a. translocation b. leaf growth c. regulating water loss d. the transport of minerals D? 2. In a moist area of the woods, you see a mass of small, green plants with tall, thin, non-green projections coming from their
  8. Biology

    14. The stomata are responsible for a. translocation b. leaf growth c. regulating water loss d. the transport of minerals D? 2. In a moist area of the woods, you see a mass of small, green plants with tall, thin, non-green projections coming from their
  9. Biology

    14. The stomata are responsible for a. translocation b. leaf growth c. regulating water loss d. the transport of minerals D? 2. In a moist area of the woods, you see a mass of small, green plants with tall, thin, non-green projections coming from their
  10. Biology

    Suppose you're a physician treating an infant with respiratory distress syndrome. Your intervention to effect relief of the baby's symptoms will involve? A. alveolar macrophages B. an artificial surfactant C.antibiotics D. oxygen This site says that an
  11. Biology

    28. Natural selection causes a. changes in the environment b. plants and animals to produce more offpsring than can survive c. changes in the frequency of certain favorable characteristics in a population d. all of the above D? 30. When Darwin published
  12. Biology

    What would happen if your liver stopped producing sufficient quantities of bile salts? A. You would develop gallstones B.Your small intestine would have trouble breaking up fat globules. C. Your small intestine would have trouble neutralizing acid from
  13. Biology

    28. Natural selection causes a. changes in the environment b. plants and animals to produce more offpsring than can survive c. changes in the frequency of certain favorable characteristics in a population d. all of the above D? 30. When Darwin published
  14. science

    A science teacher tells her class that their final project requires the students to measure a specific variable and determine the velocity of a car with no more than 2.5% error. Jennifer and Johnny work hard and decide the velocity of the car is 34.87 m/s.
  15. Biochemistry, Biology, Chemistry

    An enzyme works on two substrates, S1 and S2. Its Km for S1 is 100mM and its Km for S2 is 10mM. Based on this information, answer the following questions: 1. For a given [E] will it have a higher Vmax for S1 or S2? Explain your answer 2. Is S1 or S2 a
  16. 5th grade math and science question

    Can you tell me if I answered these correctly? SCIENCE: How is the basic structure of living organisms different from that of non-living organisms? MY ANSWER: Living things need energy, nutrients, water and sunlight. Non Living things have no life at all.
  17. Biology

    1.Which of the following accurately describes the relationship between cyanobacteria and halophiles? A.Cyanobacteria are photosynthetic, which suggests they existed before halophiles. b.Halophiles can survive in extreme conditions, which suggests they are
  18. Biology

    Technology is equipment used to do something or make something. Biochemical technology or biotechnology refers to the use of living organisms for the formation of products useable by humans. Recombinant DNA technology is one type of biotechnology. List the
  19. BIOLOGY

    What are the CELL MEMBRANE PROTEINS ? What are the functions of the CELL MEMBRANE PROTEINS ?
  20. biology

    the molecular weight of the protein is about 45 kilodaltons, and the molecular weight of glucose is about 180 daltons. jHow can you estimate the number of molecules of glucose in the 5% solution compared to the number of albumin molecules in its 5%
  21. Biology

    Why do you think biologists use both the embryological development and the adult body plans to classify an animal? My answer: Biologists use both because there are many different phyla in the adult body plans. The embryological development help
  22. Arithmetic progression

    In a class test some of the answers obtained by Neha in mathematics and science is 28 had she got 3 more in maths is 4 marks class in Science the product of marks in obtained in 2 subjects would have been 180. find the marks obtained is 2 subjects
  23. biology

    can anyone help please??? im asked to explain the meaning of glycosidic C1 - C4 Linkage. Im not 100% clear on it!! Any ideas?? Thanks C1 is the carbon on one molecule, C4 is a carbon on another molecule, Since C1 and C4 or on opposite ends of the glucose
  24. evolutionary machanism - BIOLOGY

    A flock of migrating birds is blown off course by a storm and carried towards a small island that has no birds. Only three of the birds survive the storm and make it to the island. They start to reproduce and, after several years there are 500 birds on the
  25. Biology

    The ability to roll the tongue (R) is determined by a dominant gene while the recessive gene results in the inability to roll the tongue (r). A man and his wife can both roll their tongues and are surprised to find that their son cannot. Explain this by
  26. Biology

    Which substance does not leave the nephrons by active transport? a)Potassium ions b)Water c)Calcium ions d)Phosphate ions e)glucose I think its either water or glucose... Another question.. Two strategies- negative feedback and antagonistic hormones- have
  27. Biology

    In order to predict the percentage of males and females three assumptions must be considered: 1. The X carrying sperm and Y carrying sperm have an equal chance of fetilization: 2. The egg and sperm combine at random: 3. the XX and XY zygotes have equal
  28. biology - dna

    If a DNA double helix is gradually heated, which bonds in the molecule will break first (are the weakest)? A. bonds between the nitrogenous bases B. bonds between the bases and the sugars C. bonds between the sugar and phosphate within a nucleotide D.
  29. biology

    biolgist concludes that a molecule moves across cell membrane by facilitated diffusion because the molecule is small, polar and can accumulate inside cells even when its concentration inside the cell initially is higher that it is outside the cell and they
  30. Biology

    Before meiosis, replication takes place. Therefore each chromosome is made of two_______. During meiosis I synapsis takes place. Synapsis takes places. Synapsis occurs when homologous chromosomes________and line up side by side which results in the forming
  31. Biology

    A couple has a child with an autosomal recessive form of glycogen storage disease, a deficiency of a lysosomal enzyme. An enlarged liver and heart and weak muscles cause the baby to die from heart and lung failure at 20 months. Now the woman is pregnant
  32. Biology

    I'm looking for an explanation of the clotting cascade. It is supposed to be complete, but not 5 pages long! I put "clotting cascade" into Google search and received a wealth of information. Check these out.
  33. Biology

    how does the structure of green cell organelles relate to the metabolic process of photosynthesis and aerocic respiration many thanks http://en.wikipedia.org/wiki/Chloroplast http://en.wikipedia.org/wiki/Light-dependent_reaction
  34. math

    Sheryl correctly answered 85% of the questions on her 200-question biology final. Fernando scored a 90% on his 180-question chemistry final. (a) Who answered more questions correctly? ____________________ (b) Who answered more questions incorrectly?
  35. biology:plz someone help

    The heart lung machine is used so that surgeons can operate on the arteries supplying heart muscle. These arteries may be diseased. (a) Name these arteries and explain how they may become diseased. (b) suggest why a patient is put on a heart lung machine
  36. 4th Grade - Science Fair Project

    Which brand of band-aid sticks best? How does Generic vs. Name brand differ in the way the band-aid sticks? Is one better than the other? Is there a site to help me with this Science Fair Project? Can't find one about Band-Aids????
  37. 4th Grade - Science Fair Project

    Which brand of band-aid sticks best? How does Generic vs. Name brand differ in the way the band-aid sticks? Is one better than the other? Is there a site to help me with this Science Fair Project? Can't find one about Band-Aids????
  38. Biology I

    Each level of classification is based on: general characteristics, or shared characteristics, or general characteristics & shared characteristics & specific characteristics. Thanks
  39. Biology

    name three ways somatic cells are different from gamete cells. 1. Gametes are sex cells and are always haploid 2. Somatic cells are non sex cells 3. ?
  40. English

    Here is the second part of the school description I need to translate. Some words are unclear and the sentences are too wordy. I need your help to improve them. 1) third branch includes the study of two foreign languages: English and French and addresses
  41. biology

    cystic fibrosis is caused by a recessive allele. A child has cystic fibrosis, even though neither of his parents has cystic fibrosis. If this couple has another child, what is the probability he or she will NOT have cystic fibrosis ?
  42. Biology

    The absorbance of a protein solution measured in a 1.0 cm cuvette at 278 nm was 1.145. The protein content of that solution, calculated from quantitative amino acid analysis, was 256 micrograms/mL. Calculate the extinction coefficient of the protein in
  43. Biology, please help

    Gametes produced in the process of meiosis in humans (chromosome 4)has a long and short arm the short arm has the gene for Huntington's (H) attached and the long arm the gene for Red hair (R) state the differences in the product cells at telophase II if a
  44. biology (fill in the blanks)

    Big picture of natural selection/ keep in mind… Natural selection doesn’t move in a BLANK BLANK Natural selection is not a BLANK process Natural selection isn't BLANK; Its all relative to the BLANK. Its from a study form. These are the ones I don't
  45. biology 6

    the giant anteater of south america, the giant armadillo of north america, the giant pangolin of Africa and the spiny anteater of Oceania share many characteristics. They all eat ants, have long narrow snouts, few teeth and large salivary gland, yet they
  46. AP biology

    I posted this question three days ago but no one answered. Hi you guys I am having trouble with the "cell communication" chapter so I would really appreaciate if someone could help out with this question "What could happen to the target cells in an animal
  47. biology

    time day 0 day 1 day 3 day 4 day 5 day 7 count blank 7 10 5 14 9 8 low 45&49 64&70 62&69 75&79 80&82 68&72 high 45&49 72&78 100&112 180&195 250&267 208&226 Calculate the cell yield for the following data that were obtained using a coulter counter.
  48. Biology

    184 nucleotides are bonded in a linear array, forming a nucleic acid. How many molecules of water were formed as a result of this polymerization? (Points: 4) a. 183 b. 185 c. 92 d. 368 Hint: Nucleotides are linked together by dehydration synthesis to form
  49. Biology

    Which plant cells lack a nucleus? A) sieve cells B) xylem C) companion cells D) both companion and parenchyma cells E) both xylem and sieve-tube cells Why is the answer E?
  50. Gr.11 Biology

    In humans, muscular dystrophy is a condition in which the muscles waste away during early life, resulting in death in the early teens. It is due to recessive sec-linked gene. A certain couple have 5 children- 3 boys, ages one, three and ten; and 2 girls,
  51. Biology

    In hopes that this will actually get answered-- Match the terms with the appropriate descriptions. Digestive Excretory Skeletal Circulatory Nervous Respiratory Reproductive _______________________ A. coordinate body activities B. Removal of waste
  52. Biology

    Which of the following does not function is suspension feeding? This makes no sense. I am not sure what you are asking, since you did not indicate what is "following." I searched Google under the key words "suspension feeding" to get these possible
  53. Science

    I am doing a science project about which juice cleans pennies best. I tried lemon, orange, and apple juice. I did three trials of my experiment. On average, the orange juice cleaned the pennies much better than the lemon or apple juice. My research shows
  54. biology

    5. A researcher finds that blood alcohol levels cause progressive damage to the liver. All the mice in his study were fed the same amount and types of food. Different concentrations of alcohol were injected into each mouse. One group of mice does not
  55. biology

    Replication of the E. coli chromosome takes 40 to 45 minutes, but the organism has a generation time of 26 minutes. How does the cell have time to make complete chromosomes for each daughter cell? For each granddaughter cell? my reponse was that the cells
  56. biology

    Smooth edged leaves (S) dominant over rough edged leaves (s). Two plants heterozygous for smooth edged leaves are crossed. What proportion of the offspring are expected to be smooth edged leaves? a. 1/4 b. 1/2 c. 3/4 d. 1
  57. Biology

    My mom was average height and my dad was short and mine short. I am think my genotype is heterozgous. My mom weight is average and my dad was overweight and my was average. I am think my genotype is homozygous.
  58. Biology

    9. A molecule shaped like a spiral staircase (double helix) is a typical of a. deoxyribonucleic acid b. ribonucleic acid c. carbohydrates d. both a and b D 14. Surface area is an important factor in limiting growth cell because a. the cell may become too
  59. Biology

    3. One different between a point mutation and a chromosomal mutation is that A. A point mutation affects the DNA of more genes than a chromosomal mutation B. A point mutation can involve a insertion or deletion, but cannot result in a frameshift C. A
  60. biology help

    color blindness is a sex linked disorder caused by recessive allele on the X chromosome. XC= normal vision. Xc= color blind. if a normal vision man marries a color blind woman, what are the chances that they will have a color blind son? what a color blind
  61. biology

    phytoplankton-> krill-> squid-> sea lion-> killer whale which of the following would most likely be eradicated by the bioaccumulation of PCBs in the food chain shown above? a- krill b- squid c- sea lion d- killer whale
  62. mathematics

    1. In an examination conducted for 80 candidates, those who passed in mathematics were 17 more than those who passed science and 9 failed both subjects.14 candidates passed both subjects. I. Draw a venn diagram to illustrate this information II. How many
  63. biology

    rana pipiens, a species of frog, has a diploid chromosome number of 26. a. how many chromosomes are present during metaphase i? per cell? b. how many chromatids are present during anaphase i ? per cell? c. how many centromeres are present during telophase
  64. Biology

    in cattle a dominant gene (N) results in a deep notch in each ear. a recessive gene (n) results in an "udder" abnormiality when in the homozygous condition. a farmer desires to rid his herd of these characteristics. which of these two alleles would be
  65. Biology

    1. Ferrets have 40 chromosomes in each heart cell. There are ____ chromosomes in each egg. Answer: 20 2. If a skunk has 25 chromosomes in each gamete, then how many chromosomes are in each sperm cell? Answer: 25 3. Sheep have 27 chromosomes in each cell
  66. biology

    The heart lung machine is used so that surgeons can oprate on the arteries supplying heart muscle.the arteries may be diseased. (a) Name these arteries and explain how they may become diseased (b) suggest why a patient is put on a heart lung machine during
  67. biology

    The heart lung machine is used so that surgeons can operate on the arteries supplying heart muscle. These arteries may be diseased. (a) Name these arteries and explain how they may become diseased. (b) suggest why a patient is put on a heart lung machine
  68. Biology

    Ferrets have 40 chromosomes in each heart cell. There are ___ chromosomes in each egg. Answer: 20 If a skunk has 25 chromosomes in each gamete, then how many chromosomes are in each sperm cell? Answer: 25 Sheep have 27 chromosomes in each cell that had
  69. biology

    1.What is the % concentration of oil in the first, second, and third trophic levels in our food chain? 2.How did the concentration of oil change from one trophic level to the next? 3.How does the change in concentration represent biomagnification? 4.How
  70. Biology Research Paper

    Is this alright as my 'hooking' beginning? We find it mixed in our food on the shelves in the supermarket, we find it growing in a plot down the lane, test field release sites with genetically engineered rape seed, sugar beet, wheat, potato, strawberries
  71. biology

    all test crosses are back cross. but all back crosses are not test cross. justify the statment
  72. biology

    compare the size of a guard cell to the size of a chloroplast. does the guard cell have room for more chloroplast
  73. biology

    The purines in DNA are A. thymine and cytosine B. thymine and guanine C. adenine and guanine D. adenine and cytosine
  74. Biology

    what are 2 places genes are found in animal cells and what are 3 places genes are found in plant cells?
  75. Biology

    The purines in DNA are A.thymine and cytosine B.thymine and guanine C.adenine and guanine D.adenine and cytosine
  76. Biology

    Danielle was born with a birth defect which resulted in a lack of primary auditory cortex formation. Which of the following will likely result? a. Danielle will not be about to hear from her right ear. b. Danielle will not be able to hear at all. c.
  77. Biology

    a genetisict studying coat color in animals crosses a male bunnicula having the genotype CC with a female having genotype Ccand the little subscript letters ch. The geneticist then crosses a cc(small letters ch) male with a Cc(small letter c) female. make
  78. biology

    I have to do a line graph showing generation time every 20 mins a cell diving upto 360 mins. using binary fission . am getting mixed up how to mark it down on two axis.9 boxes with mini boxes of 10 in axis i was going to use for time and vertical axis has
  79. Biology - please help

    After a strain of bacterial cells is exposed to a chemical mutagen, only 30% of the cells produce new colonies that continue to grow. Which of the following can be concluded? A. Some cells underwent advantageous mutations. B. Some cells underwent neutral
  80. Biology

    After a strain of bacterial cells is exposed to a chemical mutagen, only 30% of the cells produce new colonies that continue to grow. Which of the following can be concluded? A. Some cells underwent advantageous mutations. B. Some cells underwent neutral
  81. English

    Are the "Notes on Punctuation" by Lewis Thomas actually about punctuation? We were asked to "close read" it and I'm sure the author had other messages to get out other than punctuation. I looked Lewis Thomas up on google and found that he was quite into
  82. Biology

    hypoxia triggers increased ___ secretion? is it carbon monoxide? or erythropoietin? After oxygen diffuses into pulmonary capillaries, it diffuses into ___ and binds with __? a;interstitial fluid;RBC? b;interstitial fluid;C02? c;RBC:hemoglobin? d;RBC:C02?
  83. Biology

    Which one of the following statements about sense receptors is true? A)Chemicals, light and pressure convert stimuli into electrical implses. B) Electrical impulses within the nerve pathways trigger an awareness of stimuli in the sensory receptors
  84. Biology 20

    10 subjects consumed 8 cups of coffee within 1 hour. and 10 subjects consumed 8 cups of water in the same time period. The subjects were asked to collect and measure the amount of urine they produced. a) what is the probable hypothesis or relationship
  85. biology 20

    10 subjects consumed 8 cups of coffee within 1 hour. and 10 subjects consumed 8 cups of water in the same time period. The subjects were asked to collect and measure the amount of urine they produced. a) what is the probable hypothesis or relationship
  86. biology

    I'm doing a paper on a case study. The man, John Doe, is 55 years old, has high cholesterol, and has experienced frequent chest pains, profuse sweating, dizziness, and shallow breathing. These are the questions I have to answer: 1) What physiological
  87. Science

    Please help, I am so bored by my science lesson that I can barely focus. I read the lesson, and 5 seconds later I don't even remember what I just read. Any ideas on somehow making the Atmosphere and Solar Effects more interesting? I like history a thousand
  88. Science ?

    I was making some instant coffee and it had clumped up...I was heating up some water to go and make coffee... Then I just looked in the container and started to shake the container with the lid off a bit..that is when I knoticed the larger clumps of
  89. English

    I urgently need you to check these sentences. Thank you very much! 1) I'be been really disappointed to read that our German partner doesn't want your school to join in. Actually, we won't be probably part of the partnership, too. 2) Though English is
  90. Biology

    1. Are the third-order heterotrophs consumed by gungal decomposers? My guess:Yes? 2. Which of the following fixes atmospheric N2 (nitrogen gas)? A. photosynthesis B. symbiotic bacterianon the roots of legumes C. uv light D. decay organisms E. autotrophs My
  91. Biology

    An example of homologous structures would be our front teeth and ___: a. the mandibles of a crab b. the mouthparts of a mosquito c. the beak of a bird d. the tentacles of a sea worm e. the front teeth of a horse I'm having difficult on which answer is
  92. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5:
  93. biology

    1. A population which meets the hardy- weinberg requirements: a. Evolves b. is small and usually isolated c. has allele frequency in equilibrium d. changes genotypic distribution from generation to generation e. always has 75% A and 25% a allele
  94. Biology

    I have a research article about the early advancement of laying times for Flycatchers, a bird species through Europe and Asia. My variables are: - Annual temperature recordings in each study site - The species, flycatcher - Clutch size of the flycatchers -
  95. Biology..please help

    This is data collected.. Solute: Bowman's Capsule, Glomerus, Loop of Henle, Collecting Duct protein: 0, 0.8, 0, 0 urea: 0.05, 0.05, 1.50, 2.00 glucose: 0.10, no data, 0, 0 chloride: 0.37, no data, no data, 0.6 ammonia: 0.0001, 0.0001, 0.0001, 0.04
  96. Biology

    Kay so these are the strands of DNA 5' C C A G T A G T T 3' 3' G G T C A T C A A 5' Let's say the DNA molecule above were the parent strand of DNA. when the strands are split for replication, which strand would be the template for the leading strand? And
  97. biology

    A. The change in Gibbs free energy of ATP synthesis (acknowledging the body requires 46.3 kJ/mole) is.. This reaction is endergonic or exergonic? The energy for ATP synthesis comes from Is energy used to make ATP transferred in a single reaction or is it
  98. Biology

    "In guinea pigs, a spotted coat is dominant to uniform coat colour. If a heterozygous spotted coat guinea pig is bred with a uniform coat guinea pig, use a Punnett square to determine the genotypic and phenotypic ratios of the offspring."
  99. Biology

    What's high specific heat is mainly a consequence of the: A) high specific heat of oxygen and hydrogen atoms B) inability of water to dissipate heat into dry air D) absorption and release of heat when hydrogen bonds break and form E) fact that water is a
  100. Biology

    26. The relationship between population growth and resources can be described as a. inverse; as one goes up the other goes down b. parallel; when one goes up so does the other c. complex; there are many contributing factors d. equal; they both level off in