science, biology

41,125 results, page 4
  1. Science - Biology

    After spraying crops with DDT for several years, farmers found that populations of insect pests rebounded. One reason was that the insects had developed resistance to the insecticide. Suggest another reason, based on what you know about populations,
  2. Science , Biology

    Is Atlantic spadefish Nocturnal or Diurnal? Carnivore, Herbivore, Autotroph? Is Porcupine fish Carnivore, Herbivore, Autotroph? Please give me informationsss!!
  3. Biology (High school science)

    If non-nucleated cells of meristematic tissue are used for tissue culture, then growth rate will be : a) High b) Average c) Very low d) Growth may not take place. Please help!
  4. Mathematics

    A survey of 100 students produced the following statics: 32 study mathematics, 20 study physics, 45 study Biology, 15 study mathematics and biology, 7 study mathematics and physics, 10 study physics and Biology, 30 do not study any of the three subjects 1,
  5. BIOLOGY TEACHER

    Biology teacher help me with two questions. what role do microorganisms play in ecological succession? describe ecological succession in terms of changes in the abiotic parts of an ecosystem
  6. Biology

    Im doing an experiment in Biology on a drug, but im not sure where I can find information on the drug Chantix. i also have a few general questions I was hoping you could help me with... 1. Why is it improtant to have as many subjects as possible in an
  7. Biology (Psychology)

    What could you infer/say if a person could distinguish the difference between regular and low fat foods? It's for my science fair project. Like, besdies saying that they have an extraordinary sense of taste... >.> And make it about the individual;
  8. Biology

    I am analyzing a scientific article for my biology class. I am trying to comprehend all of the terms used and am hoping I can gain other's insight as to where this article is flawed and what could have been done to improve it. The article is titled: Effect
  9. Science

    Sir, I am Raveesh, I have done my M.Sc in Botany and B.Ed in Chemistry and Biology. Now i am working as a Lecturer in a college from last 2 years. I really interested to do online tutoring as a TUTOR / e-tutor. But I don't know how to do? Because I stay in
  10. English

    Identify the sentence that is correctly punctuated. A. Clara did not study very much for her biology test, therefore, she guessed at many of the answers. B. Clara did not study very much for her biology test; therefore she guessed at many of the answers.
  11. English

    Identify the sentence that is correctly punctuated. A. Clara did not study very much for her biology test, therefore, she guessed at many of the answers. B. Clara did not study very much for her biology test; therefore she guessed at many of the answers.
  12. English

    Identify the sentence that is correctly punctuated. A. Clara did not study very much for her biology test, therefore, she guessed at many of the answers. B. Clara did not study very much for her biology test; therefore she guessed at many of the answers.
  13. science

    Using what you learned about science in your coursework thus far, discuss: 1. Why you think scientists probably want to leave what they do open to revision. 2. What are the hard-and-fast rules of science? Are there any? 3. With so few firm rules, how does
  14. Math

    100 students were asked whether they are taking psychology or biology. 61 were taking pyschology, 18 were taking both and 12 were taking neither. how many were taking biology?
  15. Chem

    why is an understanding of chemistry important in biology? All digestion, nutrition, muscle usage/reactions, cell division/reproduction, and all of the enzymatic processes at work in the body are chemisty. Even eyesight is a chemical reaction. So you need
  16. BIOLOGY

    Hi, For my biology homework, I need to know some things about: red blood cells white blood cells (both types) platelets and I still cant find some info- -where they are made -length of life of cell Thanks! Jessica
  17. Are there any Biology teachers that could help me?

    Are there any Biology teachers that could check my answers for me?
  18. biology project

    i want a topic for investigatory project of biology...
  19. Science/ Biology/ patho

    3. A 32-year-old man comes to his physician complaining of frequency, dysuria, and urgency for several days, as well as pain in the perineal region. The digital rectal examination is extremely painful. He most likely has A. A primary chancre of syphilis in
  20. math

    In a high school, 30% of student take physics, 15% of students take chemistry. The rest of students are taking biology. What is minimum student taking biology? A.7 B.8 C.9 D.10 E.11
  21. Science

    Hi, I have two questions about biology I need help with. 1) Some questions fall outside the realm of science, which of the following questions could not be answered using the scientific method? A)What is the function of the appendix in human beings? B) Why
  22. biology

    For this assignment you will be using the course companion Web site, MasteringBiology. View and complete the MP3 tutorial: The Process of Science. and “How Does Acid Precipitation Affect Trees?” After completing the activity, develop two alternative
  23. ALL OF JISHKA STAFF

    Hello I had a couple of questions and was woundering if you have staff members that are teaching or have taught AP BIOLOGY AP PHYSICS B AP CALCULUS AB AP CHEMISTRY I was told that the AP BIOLOGY teacher had gotten extremly ill =(, has he come back? Also
  24. biology

    what are the factors needed for the growth of bacteria? Since this is not my area of expertise, I searched Google under the key words "bacteria 'growth factors'" to get these possible sources: http://textbookofbacteriology.net/nutgro.html
  25. science

    Question: Why are "apparently" small changes in pH so important in Biology? Answer: pH levels are each a 10-fold change so a change by 2 is actually a change by 1000. pH determines certain characteristics in organisms that allow them to live in certain
  26. AP Biology

    We just did the Osmosis and Diffusion lab in Biology. My teacher wants us to use water potential (and its equation) to explain the results....how do I use the water potential equation?
  27. Math

    At small town high there are 100 students,each of whom takes atleast one of Biology,Chemistry,or physics.There are 50 student in Biology,60 in chemistry,and 70 in Physics.If 24 students are enrolled in exactly two of the classes,how many students are in
  28. MATHS&SCIENCE

    Do I qualify for an application for a Sasol bbursary as I am currently studing s1 at University of Johannesburg.I have an "A" for maths SG,"D" for P.Sience HG,"D" for Biology HG,"B" for Sepedi 1st Lang HG,"D" for English 2nd Lang HG&"E" for Afrikaans 2nd
  29. MATHS&SCIENCE

    Do I qualify for an application for a Sasol bbursary as I am currently studing s1 at University of Johannesburg.I have an "A" for maths SG,"D" for P.Sience HG,"D" for Biology HG,"B" for Sepedi 1st Lang HG,"D" for English 2nd Lang HG&"E" for Afrikaans 2nd
  30. Please Help Me :( Science: Biology, Genetics!

    Please help me with science genetics questions? Thanks to all who answer!! :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is
  31. Biology

    Describe two scientific theory (atomic,kinetic,cell theory) and non scientic (moral, ethical, religious theories ).Differentiate between the scientific and non scientific theories explaining why there are some questions that science cnnot answer.
  32. Science (Biology)

    What part of the scientific method is this step? The choices are identifies a problem, gather info, state a hypothesis, experiment, observe & record data, or conclusion. Here is the step: Dan timed the eclipse in minutes and seconds. He wanted to see if
  33. Very quick question biology

    I'm working on a biology project where I must make a molecule of glucose. I have finished my molecule but I want something in the middle of it which is the "centrepiece ". Can anyone give me any ideas of some things glucose is found in (food) in which I
  34. STATISTIC HELP

    1.M&M candies are great for probability. The following tables are the color distributions for the candies. Fill in each table with the missing probability and answer the questions that follow. Plain Brown Blue Green Orange Red Yellow Probability 0.3 0.1
  35. Biology - fossils

    my sister Shreya be sick so i posting her biology questions. one question ask hw did creationists explain fossils. she write this be about noah's flood but what be noah's flood? i look up on internet for her and there be too much confusing words. i only be
  36. science fill in the blanks help!!!!!!!!!!!

    One group of three nitrogen bases codes for one ______ Is there a context in which this is used? http://www.biology-online.org/dictionary/Codon one group of three nitrogen bases codes for one ________?
  37. bio101

    2. Find a media piece—article, video, presentation, song, or other—that recognizes the fundamental concepts of chemistry in biology. Include the link or reference citation for the piece and describe how it helped you better understand how fundamental
  38. Psychology

    Need help double checking these tricky psychology questions. I put an asterix (*)next to my answers, Thanks! Which of the following fields is the best example of psychology as a basic science? A-Educational psychology B-industrial organizational psychology
  39. BiologyI

    Discoveries in DNA, cell biology, evolution, biotechnology have been among the major achievements in biology over the past 200 years with accelerated discoveries and insights over the last 50 years. Consider the progress we have made in these areas of
  40. biology

    I got a biology project that's about the excretory system & I have to write the word excretory & draw pictures inside of the word that compares it to real life. What pictures can something be compared that involves with the system?
  41. Science

    Develop three guidelines based on the four scientific principles of sustainability for our use of genetic engineering and synthetic biology to modify species and ecosystems. I know the four scientific principles are: 1) Reliance on solar energy 2)
  42. Science/biology

    A 62 year old man experiences sudden onset of difficulty breathing, followed by double vision, and later by abnormal kidney and liver function tests. Of the following conditions, which is most likely the cause of his problems? A. Vasculitis​​
  43. ECONOMICS

    The following table illustrates the points a student can earn on examinations in economics and biology if the student uses all available hours for study. Economics Biology 100 40 90 50 80 60 70 70 60 80 50 90 40 100 Plot this student’s production
  44. Biology

    Find a recent (from 2009 June onwards) and interesting article from the mass media with a theme that is related to topics learnt in Cell Biology. So far I've learnt Membrane Structure & function,Organelles and their structure & function, as well as their
  45. english

    Hi I have some questions and I would really if you answer my questions! I want to be Nurse Practitioner and I am very passion about it. But I have a lot of problems. First English is not my native language, second I am not good at math, third I am kind
  46. Science , Biology

    Cretaceous extinction... The evidence tells you that “overwhelming evidence suggests that the extinction was caused by a 10-km-diameter asteroid that struck Earth.” Suggest at least three lines of evidence that might have led scientists to this
  47. Biology

    Write an equation to summarize the photo reaction of photosynthesis. Since this is not my area of expertise, I searched Google under the key words "photosynthesis equation" to get these possible sources: (Broken Link Removed)
  48. Environmental Science

    Develop three guidelines based on the four scientific principles of sustainability for our use of genetic engineering and synthetic biology to modify species and ecosystems. I know the four scientific principles are: 1) Reliance on solar energy 2)
  49. Psychology

    Need help double checking these tricky psychology questions. I put an asterix (*)next to my answers, Thanks! Which of the following fields is the best example of psychology as a basic science? A-Educational psychology B-industrial organizational psychology
  50. Math

    At Small Town High there are 100 students, each of whom takes at least one of biology, chemistry, or physics. There are 50 students in biology, 60 in chemistry, and 70 in physics. If 24 students are enrolled in exactly two of these classes, how many
  51. Science

    A biology class wants to perform an experiment to investigate the effect of different colors of light green, yellow, red, and clear cellophane and plant three seeds in each one. What part do the three seeds experiment? A. Confounding variable B.
  52. English

    One last thing. I varied this sentence since we are going to involve students from different third classes.I don't know how to express the second part. Pupils taken from different (or various) tenth classes will be involved in the project since the
  53. Science/Biology

    A woman once had a beautiful rubber tree, but when her sister saw her watering it, she laughed and asked why she was watering an artificial plant. So she stopped watering the plant, and in a few months it died. Explain, using at least five characteristics
  54. Science

    I have to do a project with a science related career (that doesn't necessarily mean a scientist, but someone who uses science frequently). What do you call a scientist who studies the science of music? I've google this but I couldn't find any results, but
  55. For A Science/Biology teacher

    Ectothermic organisms have body temperatures that vary with the temperature of their surroundings. Discuss the effect this variation might have on the functioning enzymes in these organisms. Suggest ways ectothermic organisms might cope with this problem.
  56. BiOlogy

    I did a lab biology project on seed germination and the results weren't as expected. pH 5 worked better than pH 6 or 7 which seemed weird because surely it would be too acidic. I've been trying to find an explanation as to why I got these results and I
  57. Biology/Science

    1. A corn plant over the course of a summer can weigh 500 grams (dry biomass, after removing the water), yet it starts from a seed that weighs less than 1 gram. What is the primary source of this increased mass? What process(es) are responsible for the
  58. Statistic Please Check

    Check this out please Thanks Lesson 3 Unit 2 Probability Couplements, Disjoint Events and the addition Rule 1.M&M candies are great for probability. The following tables are the color distributions for the candies. Fill in each table with the missing
  59. Organic Chemistry/Biology

    My text has a review of some chemistry before getting into the biology bit. I have come to a question "what are 3 characteristics/features of an organic compound." My book seems to only have the general they all have carbon. The rest goes into depth about
  60. Science - biology - university

    A couple where both the man and woman are albino decided to have children. Remember that albinism is inherited as a rare autosomal recessive trait. To their surprise their first child had normal skin pigmentation. They eventually have two more children and
  61. science, biology

    what are features of food chain? The food chain tells what creatures eat other creatures. I searched Google under the key words "food chain" to get these possible sources: http://www.vtaide.com/png/foodchains.htm
  62. math

    In a class of 50 student 28,22,20 of them offer physics,chemistry and biology respectively also,4 of them offer physics and chemistry but not biology,3 offer physic and biology but not chemistry,6 offer biology and chemistry but not physics if 13 of them
  63. biology

    A question in Campbell's 8th edition study guide for AP Biology says: A multifactorial disorder _. Answer: has a collection of symptoms traceable to an epistatic gene. There is another answer choice which says : has both genetic and environmental causes.
  64. science

    One of the five charateristics of living things is being able to reproduce. Do all living things have to have all charateristics? Mules are living things and most are sterile. (I have heard of a few cases where a mule has given birth.) What about women who
  65. 7th grade math

    A biology class has 28 students. Four of the students transferred out to take chemistry. Find the percent of change in the number of students in the biology class. I got 86 percent change is that right? Thank you...My mom says it's 14.3 %
  66. Biology

    Hi, I have 4 questions regarding Biology. 1. Does a different chromosome number in two species represent a significant difference? 2. Chromosome 7 has an extra band at the top in chimpanzees; does this extra band affect the quantity of coding DNA? And does
  67. Science

    An area in your state has been flooded due to heavy rains. How might scientists from the three main branches of science interact in their study of the flood, its effects, and how future flooding might be controlled? Life science, Earth science, and
  68. biology/science

    Oxygen attracts electrons more strongly than hydrogen does. What kind of bond forms between the two hydrogen atoms and single oxygen atom that form a water molecule? A. A metallic bond B. A hydrogen bond C. An ionic bond D. A polar bond Currently stuck
  69. Science

    I am trying to find an example of how to write a prediction for a Biology Lab Report. I think a prediction should be written as an if/when statement. Does anyone know of some where that I can find a lab report that includes a prediction(s)? All of the
  70. math

    65 men 75 women are enfolled in calculus. There are 30 business majors, 40 biology majors, 50 computer science majors, and 20 mathematics majors. No person has a double. If a single calculus student is chosen, find the probability that that the student is
  71. Science

    Science project ideas for science fair. I need to prepare a model for science fair. But I need some ideas about the major problems facing today's world. So that I can get idea for improvement in any area and to show this in science fair. Please get me know
  72. Biology

    I think this is a shot in the dark, but worth a try. I have the Biology: Life on Earth by Audesirk, Audesirk & Byers 10th edition bought used online, apparently there are some pages missing in the book, so I can't do my homework, if anyone has the book
  73. Quizzes biology

    Hello, my teacher has once said that she gets all of her quizzes from the internet, but I can't find the site. Does anyone have any idea as to where grade 12, hard, biology quizzes may come from? The quizzes are brutal, and it would so great if I could see
  74. science(biology)

    all test crosses are back cross but all back crosses are not test cross.i want to justify this statment.plssssssss
  75. Biology 10

    Having studied biology, and listened to instructions, you recognize there is a method that could be used to decode and solve these cryptic messages. 1) TTACTCTCAAACGCCTTATGATCAAAC 2) ATAGTTGGATTTGTTAACGGACCAAAC THE CODE TABLE --------------- AAT = A ATT =
  76. AP BIOLOGY LAB

    I am doing an ap biology lab on plant photosynthesis. It's specifically lab # 4 on plant pigments and photosynthesis and it's on question # 8 on Exercise 4B: Photosynthesis/ The Light Reaction. Identify the function of each of the cuvettes. I already have
  77. Human & Social Biology

    (1)briefly discribe five main ways in which human pollute their enviroument. (2) briefly outline four inportant social problem maybe reduce by a knowledge of biology (3)discribe how social biologist may help to solve the problem of (A) stravation (b) poor
  78. SCIENCE

    jamal's neighbor tells him that there are more bacterial cells than human cells in his body. which of these is the best reason that jamal should question his neighbors statement? a. jamal is older than his neighbor b. jamal does not like his neighbor very
  79. Science Help

    jamal's neighbor tells him that there are more bacterial cells than human cells in his body. which of these is the best reason that jamal should question his neighbors statement? a. jamal is older than his neighbor b. jamal does not like his neighbor very
  80. English

    I am doing a university application form where I am asked questions it asks: *Why are you interested in this program? (100 words or less) I applied for Biological Sciences-Major Human Biology. My question is, would it be ok if I talked about the major
  81. SCIENCE-Urgent

    Right now I'm studying photosynthesis in Biology. We have to design an experiment that would prove how light reactions occur prior to carbon fixing reactions. I know how light and carbon fixing reactions work, but how can I prove this experimentally? Are
  82. Science

    Right now I'm studying photosynthesis in Biology. We have to design an experiment that would prove how light reactions occur prior to carbon fixing reactions. I know how light and carbon fixing reactions work, but how can I prove this experimentally? Are
  83. Science-Biology

    If a mother has brown eyes and a father has blue eyes why do two of their children have blue eyes and one have brown eyes?
  84. math

    the biology class has a lab every days. the earth science class has a lab every three days . which class day do they both have class ?
  85. SCIENCE-URGENT

    Right now I'm studying photosynthesis in Biology. We have to design an experiment that would prove how light reactions occur prior to carbon fixing reactions. I know how light and carbon fixing reactions work, but how can I prove this experimentally? Are
  86. Science - Biology heeelp

    Hi My question is what is the difference between insects and arachnids although they are in the same group ? thanx Thank you for using the Jiskha Homework Help Forum. Here are some links for you: 1. http://www.thinkingfountain.org/s/segment/segment.html 2.
  87. biology

    The only thing my biology teacher told us about the NADP (in photosynthesis light dependent reaction) is that it's a bus driver. Why is it a bus driver? Is it cos it collects the H+ ion into the light independent reaction (NADPH) then "drops" it off and
  88. Biology for sister

    my sister need help with biology homework she need to describe ecology of amoeba, paramecium, and diatom. telling where it be found. how it meet it nutritional needs using and explaining with the right terminology like autotrphic, photosyntetic, parasitic,
  89. math/science

    Please can you explain how to do the following: a) a non-smoker with low blood pressure has a plasma chloesterol concentration of 5mmol per litre. Over a period of time this concentration increases to 8mmol per litre. By how many times has this risk of
  90. Biology

    I have a biology project due on monday i have all the information all i need is a Graph/chart. Where can i find an athletes foot chart/graph. It does not matter what it says on the chart/graph as long as its about athletes foot. are you willing to help. I
  91. Biology

    hello my teacher today during our Biology lesson said : Diffusion occurs more easily in smaller organisms because they have a bigger surface area than theie volume from inside But us humans , we have more problems id diffusing because we have a smalller
  92. science

    The various groups who make up the US public have different expectations of science. How do these differing expectations of science affect the ways groups place trust in science? Describe one example of a controversial expectation that the author gives.
  93. Biology

    3) The following statements are generalizations about cell signaling events made by a student with a basic knowledge of biology (a little knowledge is a dangerous thing). Your professor has requested that you tutor this student. You note that in each case
  94. Biology

    I need help in my biology lab... [Catalase Lab] 1.What effect did heat have on the activity of the enzyme? What effect did cold have? Room temperature? 2. What effect did lowering pH (making it acidic) have on the activity of the enzyme? What affect did
  95. Environmental Science

    We are being asked to identify reasons that an article is or is not science using the list of 8 characteristics of science. What are the 8 characteristics of science?
  96. Science

    I have to write a paper on what I consider to be "bad science" and proved an example of what is bad science such as something from the media, commericals, scientist's statement. I was wondering if someone could help me find an example of "bad" science
  97. grade 9 science biology

    What activities increase the amount of carbon dioxide in the atmosphere? What activities decrease the amount of carbon dioxide in the atmosphere?
  98. math

    A textbook store sold a combined total of 462 biology and chemistry textbooks in a week. The number of biology textbooks sold was two times the number of chemistry textbooks sold. How many textbooks of each type were sold?
  99. mathematics

    If 45 percent of the students of a class have offered mathematics and 85 percent of them biology, find the percentage of students who offered biology only?
  100. probability

    The probability that a student passes Biology is 0.35 and the probability to pass Chemistry is 0.63. If the probability to pass both Biology and Chemistry is 0.4, what is the probability that he will pass either Biology or Chemistry?