1. math

    hi can you predict the next sequences possible from the numbers 1-50 05 16 20 30 41
  2. Biology

    When making comparison of sequences where some are whole genome sequences while others are partial genome sequences, or a specific glycoprotein sequence, How is it that we are able to make comparisons from these sequences if they all have different
  3. geometry

    predict the next two numders in this sequences:-5,-2,4,13_,_
  4. Math

    I'm learning series and sequences (grade 11). Please check that my steps show I understand what I'm doing/the concept and my answer as well: 5. The consecutive terms of an arithmetic sequences are 3.6, y, 8.2. Find the value of y. This seems to be a
  5. biology

    Below the human hemoglobin sequence are the first thirty amino acid sequences of several other species’ hemoglobins. Inspect the sequences and answer the following questions: Human) h l t p e e k s a v t a l w g k v n v d e v g g e a l g r l A) ml t a e
  6. Math (Combinatorics)

    A lottery ball drawing machine has 50 balls, each labeled with a distinct integer from 1 to 50. Every Sunday, four different balls are drawn to determine the winning numbers. You have last Sunday's ticket with the numbers {3,7,12,15}. You missed the
  7. Sequences

    A = {a1, a1 + d1, a1 + 2d1, …}, B = {a2, a2 + d2, a2 +2d2, …}. Investigate whether A + B and A x B are arithmetic or geometric sequences. If an arithmetic sequence is identified, state its common difference. If a geometric sequence is identified, state
  8. MATH!!!! SEQUENCES!!!

    Find out a formula for the Nth term of each of the following sequences. (i)4 7 10 13 16 (ii)1 3 5 7 9 (iii)20 17 14 11 8 (iv)1 4 9 16 25 (v)2 8 18 32 50
  9. algebra

    For each of the following sequences, find an explicit and a recursive description of the pattern. Assume sequences start from n = 1. a. 1, -1, -3, -5... b. 8,2,3,9... c. -2, 0, 0, -2, -6...
  10. Algebra

    Predict the next two numbers in this sequence. Leave a comma but no spaces between the numbers. 1/4, 1/9, 1/16, 1/25,...
  11. math

    Consider the following sums of numbers and how they are formed: 1 odd number } 2 odd numbers 678 3 odd numbers 64748 Predict the following sum and complete the generalization: a. 1 + 3 + 5 + 7 + 9 + 11 = ? b. 1 + 3 + 5 + Á + (2n - 1) = ?
  12. math

    I need to figure out the next two numbers in the following sequences. A)144, 121, 100, 81, B)3, -12, 48, -192,
  13. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5:
  14. math

    1. Examine the first four terms in each of the following number sequences: *2, 7, 12, 17 my formula x+5 *7, 21, 63, 189, 567 my formula x(2)+x *1000, 850, 700, 550 my formula x-150 * –10, –6, –2, 2 my formula x+4 For each sequence, what would be the
  15. Biology Help Please!

    )Describe the importance of chromatin remodeling process to transcription. Select the four correct answers. a) These alterations can be used to activate transcription of a gene by hiding its enhancer sequences. b) These alterations can be used to activate
  16. biology

    Explain how the sequences of the newly created daughter DNA sequences compare to the original parent DNA sequence. And why do they look that way?
  17. Maths: Sequences need help

    The nth term of a sequences of v1,v2,v3 is given by Vn=6 2^n (1):show that for all value of n>1 Vn1=2(Vn-3)?? (2): obtain and simplify the sum of the first n term of the sequence??
  18. Maths Please Help

    Let A=a1,a2,…,ak and B=b1,b2,…,bj be sequences of positive integers such that a1≥a2≥⋯ak≥1, b1≥b2≥⋯bj≥1, ∑i=1k ai≤6, and ∑j i=1 bi≤6. For how many ordered pairs of sequences (A,B)
  19. geometric sequences

    given the geometric sequences:9 90/17, 900/289 find an explicit formula for an, where the first term is a1=9 an= a10=
  20. math

    How many n-digit decimal sequences (using digits 0-9) are there with k 1s? Decimal sequences meaning you can have as many 0s in front of a number. For example: 000001234557891111 would be consider valid. So how do i come up with an equation? See my
  21. Biology

    Humans and Gorillas are very similar in terms of their genetic sequences; in a sample of each of their DNA sequences, only ONE difference was found. MY QUESTION: What genetic mechanism could cause this base sequence change? Thanks!
  22. masterin quantum

    Consider the left shift operator on the space of infinite sequences of complex numbers: L(z1,z2,…)=(z2,z3,…). Is L injective? Yes <text> Yes</text> - incorrect No Is L surjective? Yes <text> Yes</text> - correct No Find the
  23. Series and sequences

    Three numbers a,b, and c form a geometric series so that a+b+c=35 and abc=1000. Find the values of a,b,c.
  24. Math

    A teacher asked studets to name numbers. After each number, the teacher responded using a certain rule. This table shows the numbers named by the students and the teacher's responses Students input 1,2,3,4,5,6,7 Teachers response 3,3,5,4,4,3,5 One of the
  25. math (data management)

    How many n-digit decimal sequences (using digits 0-9) are there with k 1s? I'm not entirely sure what you question is asking, but I'll take a guess. You have n digits and k 1's with k<n There are n choose k ways to arrange the 1's in your number. You
  26. Math, Please Help!

    Ryan is building matchstick square sequences, as shown ( first one used 4, second one used 7, third one used 10, and the forth one used 13). He used 599 matchsticks to form the last two figures in his sequences. How many matchsticks did he use in each of
  27. English

    For the essay I have to write I have to talk about examples of sequences and montages (which are transitional sequences of rapidly edited images) for the movie "The Gold Rush" by Charlie Chaplin. I'm having a hard time with examples of montages. Can you
  28. geometry

    predict the next two numbers in this sequence:2,6,18,54,_,_
  29. Math

    I have to find the relationship between these sequences, and express a generality. Could you help please. 1 + 3 + 5 + 3 + 1 = 3^2 + 2^2 1 + 3 + 5 + 7 + 9 + 7 + 5+ 3 + 1 = 5^2 + 4^2 1 + 3 + 1 = 2^2 + 1^2 I'm thinking sum of consecutive primes can be
  30. Pre-Cal

    Recursive Sequences: find a formula for: 1,1,2,3,5,8,13,21 It looks like the Fibonacci sequence. Take the first two numbers and add them to get the 3rd. take the 2nd and third to get the fourth...etc. yeah, but how would i write that into a formula?
  31. Math

    Predict the numbers in the sixth role. 1.)1 2.)1,1 3.)1,2,1 4.)1,3,3,1 5.)1,4,6,4,1 6.)?
  32. Statistics

    I am doing a stats study and im stuck on what test to perform. Please look at my subject and advise me.. I am testing to see whether a person that is best in math and science will be able remember more numbers than letters and if a person that is better in
  33. Algebra-Please check

    We're learning arithmetic sequences-please check this for me-it's my first day calcuulating htese and I'm not sure If t(1) = 5 and t(n) = t(n-1) + 2, find the first 4 terms of the sequence I think it would be 5,7,9,11 because the difference is 2 so I just
  34. stats 1040

    you play a game in which you win $4 if you correctly predict the numbers of spots on a fair 6-sided die and you lose $1 if you don't correctly predict the number of spots. you plan to play 100 times. how do you set up a box model to represent your net
  35. math

    Brilli the ant placed the numbers 1,2,…,n in order clockwise around a circle. She can create an infinite sequence A={aj}∞j=0 of integers by letting a0=k∈{1,2,…,n} and constructing ai+1 from ai by taking the integer that is ai positions
  36. Math (help steve)

    Brilli the ant placed the numbers 1,2,…,n in order clockwise around a circle. She can create an infinite sequence A={aj}∞j=0 of integers by letting a0=k∈{1,2,…,n} and constructing ai+1 from ai by taking the integer that is ai positions
  37. Astronomy

    Venus is 0.72 AU from the Sun and Neptune is 30.06 AU from the Sun. Both have similar orbital eccentricities, 0.7 and 1.0 respectively. Predict how long it will take Venus to make one revolution around the sun compared to Neptune. Also predict the orbital
  38. Math

    Consider all 3-term geometric sequences with first term 1 and with common ratio the square of an integer between 1 and 1000 (inclusive). How many of these 1000 geometric sequences have the property that the sum of the 3 terms is prime?
  39. Lotto game

    This is success,55 80 83 65 3, please help me predict the three direct numbers out of it, pls help me.
  40. Maths

    From this past 4 results 17-90-48-84-41. 46-6-15-64-85. 78-41-65-50-54. 52-70-30-42-29. Can anyone predict the next 5/90 lotto winning numbers please
  41. college mathematics

    Use inductive reasoning to predict the next three numbers in the sequence. 1, 0, -2, -5, -9,
  42. algebra

    Consider all 3-term geometric sequences with first term 1 and with common ratio the square of an integer between 1 and 1000. How many of these 1000 geometric sequences have the property that the sum of the 3 terms is prime?
  43. Maths

    Consider all 3-term geometric sequences with first term 1 and with common ratio the square of an integer between 1 and 1000. How many of these 1000 geometric sequences have the property that the sum of the 3 terms is prime?
  44. Maths

    Kindly predict the winning numbers from these past results 2 draws 79-64-62-89-8 & 5-52-14-27-22.
  45. Math

    Describe a pattern in the sequence of numbers. Predict the next number. 256,16,4,2,...
  46. math

    ATM personal identification number PIN codes typically consist of four-digit sequences of numbers. Find the probability that if you forget your PIN, you can guess correct sequence if you recall the two digits
  47. Maths sequences

    Question= Find the sum of all the odd numbers up to and including 99,999. Would a=1 because its the first odd number in the sequence? And would d=2 ? So then would you do S99,999= 49999.5(2+99,998(2)) Then divide by two?
  48. Computer Organization and Architecture

    Write a subroutine MEMCMP for performing a byte-by-byte comparison of two sequences of bytes in the main memory. The subroutine should accept three input parameters in registers representing the first address, the second address, and the length of the
  49. AP Chemistry

    I am honestly lost on this question and you can't proceed without solving the first on, so if anyone would be so inclines to help me out Aluminum metal reacts with zinc(II) ion in an aqueous solution by the following half-cell reactions: Al(s) → Al3+(aq)
  50. Algebra HELP!

    Ryan is building matchstick square sequences, as shown ( first figure used 4, second figure used 7, third figure used 10, and the forth figure used 13). He used 599 matchsticks to form the last two figures in his sequences. How many matchsticks did he use
  51. AP Chemistry

    Q - Aluminum metal reacts with zinc(II) ion in an aqueous solution by the following half-cell reactions: Al(s) → Al3+(aq) + 3e− Zn2+(aq) + 2e− → Zn(s) Predict the potential of the cell under standard conditions. Predict whether the
  52. Maths

    A super-Fibonacci sequence is a list of whole numbers with the property that, from the third term onwards, every term is the sum of all the previous terms. For example, 1, 4, 5, 10, ... How many super-Fibonacci sequences with 1 involve the number 2016? A.1
  53. ELA

    Did you predict the outcome of the battle between Rikki-tikki and Nagaina? In a paragraph, explain how easy or difficult it is for readers to predict the outcome of "Rikki-tikki-tavi." What prior knowledge do they need? What events in the story help the
  54. Biology

    (This question ties into the previous question I posted about mRNA). Use the Universal triplet code to determine the sequence of amino acids that would be generated for each of the mRNA sequences that you generated in question 2. Remember that the reading
  55. Probability

    Automated chemical synthesis of DNA has made it possible to custom-order moderate length DNA sequences from commercial suppliers. Assume that a single nucleotide weighs about 5.6 X 10^-22 grams and that there are four kinds of nucleotides. If you wish to
  56. Chemistry

    2. Aluminum metal reacts with zinc(II) ion in an aqueous solution by the following half-cell reactions: Al(s) → Al3+(aq) + 3e− Zn2+(aq) + 2e− → Zn(s) a. Predict the potential of the cell under standard conditions. (4 points) b.
  57. Precalc

    To which set(s) of numbers does the number sqrt -16 belong? Select all that apply. real numbers complex numbers*** rational numbers imaginary numbers*** irrational numbers I can only pick two, and that's what I think it is. Please check? Thanks
  58. math

    Find the equation of the regression line for the given data. Predict the value of Y when X=-2? Predict the value of Y when X = 4?
  59. Maths

    Eric thinks of 2 sequences.One is geometric and the other arithmetic.Both sequences start with the number 3.The common ratio of the geometric sequence is the same as the common difference of the arithmetic sequence.If the 6-th term of the geometric
  60. chem 1411

    Mg(NO3)2 + (NH4)3PO4 predict the product and balancing the equation. Use solubility rules to predict if a precipitate is formed.
  61. chemistry

    Did the equation do not know the 2nd questions"s answers for the problems a) 2O3(g) = 3 O2(g) + heat (O3 IS UNDERLINED) [6.0x10-1] [0.21] b) 2 CO2 (g) + heat = 2 CO(g) +O2(g) (CO IS UNDERLINED) [0.103] [0.024] [1.18 x10-2] c) NO2(g) + O2(g) + heat =NO (g)
  62. chemistry

    Please help!!! Desperate for answer!!!? Did the equation do not know the 2nd questions"s answers for the problems a) 2O3(g) = 3 O2(g) + heat (O3 IS UNDERLINED) [6.0x10-1] [0.21] b) 2 CO2 (g) + heat = 2 CO(g) +O2(g) (CO IS UNDERLINED) [0.103] [0.024] [1.18
  63. I don't get this math!

    Sequences that increase at increasing rates are sometimes described as “growing exponentially”. However, this is not always a correct use of the word. For example, both quadratic (constant second difference) and exponential growth share this property.
  64. 9th grade

    Name the set(s) of numbers to which 1.68 belongs. a. rational numbers b. natural numbers, whole numbers, integers, rational numbers c. rational numbers, irrational numbers d. none of the above my answer a)rational numbers
  65. Math

    A sociology seminar has 7 members (a) They begin each meeting with each member shaking hands with all the other members. No one shakes another member's hand twice. How many handshakes take place? (b)The professor shakes hands with each member of the
  66. Math

    Shandel went to the County Fair this summer and was surprised to see a math game on the midway among the games of skill and chance. Picture of a Midway BarkerIn the game, the barker starts by thinking of a math rule or calculation. The player spins a
  67. chemistry

    Please help!!! Desperate for answer!!!? Did the equation do not know the 2nd questions"s answers for the problems a) 2O3(g) = 3 O2(g) + heat (O3 IS UNDERLINED) [6.0x10-1] [0.21] b) 2 CO2 (g) + heat = 2 CO(g) +O2(g) (CO IS UNDERLINED) [0.103] [0.024] [1.18
  68. Algebra

    To which subset of real numbers does the following number belong? square root of 7 A)rational numbers B)irrational numbers****** C)whole numbers, integers, rational numbers D)whole numbers, natural numbers, integers
  69. CITY SCHOOL

    useing these numbers: 25 - 7 - 8 - 5 - 4 - 3 make an equation so that the answer equals 828,but you can ONLY use those numbers. you cant add any more numbers and you cant repeat any of the numbers. you DON'T have to use all the numbers though
  70. math

    to which subsets of real numbers does the number -22 belong? choose all that apply a) whole numbers b) rational numbers c) integers d) irrational numbers e) natural numbers
  71. Algebra

    To which subset of rel numbers does the number -22 belong? whole numbers rational numbers integers irrational numbers natural numbers I know it's an Integer but I'm not sure of the second answer.
  72. AiMS MATH

    -5 Is A Member Of Which Subset Of Real Numbers. a) natural numbers b) whole numbers c) intergers d) rational numbers e) irrational numbers
  73. math

    list all numbers from the given set {-9,-4/5,0,0.25,/3,9.2,/100} that are a) whole numbers b) natural numbers c) intergers d) rational numbers e) irrational numbers.
  74. algebra

    List all the numbers from the given set that are, a.natural numbers b.whole numbers c.integers d.rational numbers, e.irrational numbers {-9,-4/5,0,0.25,ã3,9.2,ã100}
  75. math

    A farmer is using a random sample to predict the number of broken eggs in a shipment of 3,000 eggs. Using a calculator, the farmer generates the following random numbers. The numbers 1-250 represent broken eggs. 477, 2116, 1044, 81, 619, 755, 2704, 900,
  76. chemistry

    Predict the Products for the following reactions and write the chemical equation. Combustion: Liquid Octane, C8H18 burn in oxygen gas. how would you set this up and predict the product? Thnx in advance whoever figures it out :)
  77. Static

    The country of Statland runs a national lottery for its people. In this lottery, an urn contains 42 balls that are individually numbered 1, 2, ..., 42. Each week, 5 balls are drawn from the urn without replacement. Gamblers pay a small sum to predict these
  78. chemistry

    I have the 1st part of the answer to my question I guess what I don't understand is the 2nd part of the question. I am supposed to 1. predict how ke increases in temperature, 2. predict how equilibrium will shift when pressure is decreased and 3. predict
  79. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC
  80. Math

    Which expression is equivalent to (-2)(a+6)? -2a+6 2a+12*** -2a-12 -2a+12 To which subsets of real numbers does the number -22 belong? Choose all that apply. Whole numbers*** rational numbers integers*** irrational numbers "6 times the difference of b and
  81. chemistry

    A magic number is the name given to certain numbers of protons or neutrons that have a high correlation to stability in nuclei. Magic # of protons: 2,8,20,28,50,82 Magic # of neutrons: 2,8,20,38,50,82,126, 184 Using general trends, predict the stability of
  82. algebra

    true or false 1. fraction cant be written as decimal. 2. natural numbers are referred to as counting numbers.whole numbers consists of counting numbers.whole numbers consist of counting numbers as well as the number 0 3. intergers do not include negative
  83. Math

    Hot numbers in a lottery are numbers that keep coming up. Cold numbers are numbers that have not "hit" in awhile.Some people select hot numbers or cold numbers when buying a ticket. Using probability,explain whether this makes sense. Please answer this
  84. Math

    A block is a consecutive sequence of the same digit that is not part of a longer such sequence. a.) Determine the number of sequences of 0's and 1's of length 10 in which every block of 1's has an even length. b.) Determine the number of sequences of 0's
  85. sequence

    give the general term of the sequence 1,2,3,5,10,15,25,... Type "integer sequences" in google: Fibonacci numbers written in base 8: 1, 2, 3, 5, 10, 15, 25, 42, 67, 131, 220, 351, 571, 1142, 1733, 3075, 5030, 10125, 15155, 25302, 42457, 67761, 132440,
  86. Math

    Last Week June 16,2017 Ghana's Midweek Lottery Results were as follows Win: 05-25-71-56-19 Machine: 42-57-45-36-68 Please help me predict the next winning numbers for today June 21,2017
  87. Science

    Predict Two Organisms were found to have different genotypes but the same phenotype.Predict what these genotypes might be.Explain
  88. chemistry

    what statements are true for the standard entropy change for the conversion of ozone to oxygen? Select all the apply? 2 O_3 (g) > 3 O_2 (g) Molecular factors predict an increase in entropy Stoichiometric factors predict a decrease in entropy. Molecular
  89. Algebra 1

    To which subsets of real numbers does the number –22 belong? Choose all subsets that apply. whole numbers** rational numbers integers** irrational numbers natural numbers Maximum choice is 2
  90. Algebra

    28. Use the Distributive Property to simplify x(4x^2 + x + 4) Is it 4x^3 + x^2 + 4x? 42. To which set of numbers does 0 not belong? 46. Pi belongs to which group of real numbers? a. Odd numbers b. rational numbers c. irrational numbers C? 48. Can a number
  91. Math

    Which set of best describes the numbers used on a scale for a standard thermometer? A.whole numbers B.rational numbers C.real numbers D.integers I choose Real Numbers if I am incorrect can you explain why.
  92. biology

    Are the DNA template strand and the mRNA sequences similar, or complementary? Are the DNA coding strand and the mRNA sequences similar, or complementary? Are the DNA template and the DNA coding strand sequences similar, or complementary?
  93. chemistry

    The question is: What statements are true for the standard entropy change for the conversion of ozone to oxygen? The choices to pick from are: 1. Molecular factors predict an increase in entropy 2. Stoichiometric factors predict a decrease in entropy. 3.
  94. Algebra 2

    In 1950 the life expectancy of women was 72 years. In 1970 it was 75 years. E represents the life expectancy and T the number of years since 1950 (t=0 gives 1950 and t=10 gives 1960). a. fit a linear equation to predict life expectancy (0,72) AND (20,75)
  95. Math

    1) The numbers 2 and 3 are prime numbers. They are also consecutive numbers. Are there other pairs of primes that are consecutive numbers? Why or why not? 2) which group of numbers, evens or odds, includes more prime numbers? Why?
  96. Sequences

    For any sequence of real numbers A = {A_1, A_2, A_3, ... }, define *A to be the sequence {A_2 - A_1, A_3 - A_2, A_4 - A_3,..}. Suppose that all of the terms of the sequence *(*A) are 1, and that A_19 = A_92 = 0. Find A_1. Help me, please. Thanks
  97. Statistics

    From these past lotto results. 12/05/2011(31-25-36-48-9). 19/05/2011(16-81-59-84-76). 26/05/2011(19-2-57-69-36). Can anyone predict todays winning numbers? It's a 5/90 lotto
  98. math

    There is an 8 square box, I have to put the numbers 1-8 in the eight boxes, BUT no consecutive numbers can be by each other, and cannot be by each other vertically, horizontally, or diagonally. How can the numbers 1-8 fit in there when they can't be by
  99. Int Algebra

    The difference of two numbers is 7. The sum of the numbers is -1. What are the numbers? I've come up with two equations: x-y=7 and x+y=-1 but don't know what to figure it out from there since there are no numbers on the left side of the equation to work
  100. Algebra

    What type of number is -22?? choose all that apply... whole numbers rational numbers * integers * irrational numbers natural numbers * what I think ???