1. Calc 3

    The DNA molecule has the shape of a double helix. The radius of each helix is about 10 angstroms (1 Å = 10−8 cm). Each helix rises about 34 Å during each complete turn, and there are about 2.9 × 108 complete turns. Estimate the length of each helix.
  2. Biology

    14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of the above D? 16. During DNA
  3. Biology

    16. During DNA replication, all of the following steps occur EXCEPT a. enzymes proofread new strands for errors and correct them b. the double helix is unwound by DNA polymerases c. base-pairing rules determine which nucleotide is added to new strands d.
  4. Biology

    14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of the above D 16. During DNA
  5. Science

    I did your corrections. I just wanted to know if all the sentences are correct from a scientific point of view. Thank you. 1) DNA contains instructions which decide which proteins a cell will make and consequently determines the whole chemistry of the
  6. English

    I'd like you to check these sentences grammatically. I also would like you to see if the terminology I used is correct. Help me improve my paragraph, please. 1)DNA contains instructions which decide which proteins a cell will make and consequently
  7. chemistry

    The human body is said to contain approximately 50.0 grams of DNA in the entire body. If the number of nucleotides in ONE STRAND of DNA is approximately 3.0 x 106, and the average molar mass of a nucleotide is 327 g/mol, what is the average molar mass of
  8. Chemistry

    The human body is said to contain approximately 50.0 grams of DNA in the entire body. If the number of nucleotides in ONE STRAND of DNA is approximately 3.0 x 106, and the average molar mass of a nucleotide is 327 g/mol, what is the average molar mass of
  9. Bio

    How is information for a specific protein carried on the DNA molecule? A. As a sequence of nucleotides B. In the double helix shape of the condensed chromosome C.In the ratio of adenines to thymines D.As a pattern of phosphates and sugars A C D are all
  10. Biology - DNA

    I'm trying to figure out why DNA forms a double helix and my biology book doesn't really specify why. I know about the anti Paralell strands with the 5 prime end and the 3 prime end and the complentary base pairs and it is hydrogen bonds that connect these
  11. Chemistry

    3.Are the bases on the interior or the exterior of the double helix? Are they randomly arranged or neatly stacked? 2.Are the phosphate groups on the interior or the exterior of the DNA molecule? 3.Are the sugar groups on the interior or the exterior of the
  12. Science

    What is the used to demonstrate that the DNA molecule is a helix?
  13. Biology

    http://talk.collegeconfidential.com/showthread.php?p=4515174 Imagine you had made an RNA copy of each strand of a DNA double helix. If you were now to mix these two RNA single-strand copies together, do you think they would form a double-stranded RNA
  14. Biology

    Which of the following lists structures from smallest to largest? A. Chromosome, supercoil, coil, nucleosome, double helix B. Chromosome, coil, double helix, nucleosome, supercoil C. Double helix, nucleosome, coil, super coil, chromosome D. Nucleosome,
  15. Genetics

    The genome of Elradicus hypotheticus consists of 3 x 105 bp of B-DNA. a. How many turns are present in the double-helix? b. What is the length of the DNA in μm?
  16. Biology

    What is the name of the protein that breaks the hydrogen bonds in the double helix causing the DNA strands to separate during DNA replication? I have a test tomorrow so please help!
  17. science

    The enzyme that opens up the DNA double helix during replication.?
  18. Biology

    What holds nitrogen bases together in a Double Helix? (DNA)
  19. Biology

    which of the following list structures from smallest to largest? A. chromosome, supercoil, coil, nucleosome, double helix B. chromosome, coil, double helix, nucleosome, super coil C. double helix, nucleosome, coil, super coil, chromosome D. nucleosome,
  20. Physics

    Stretching DNA. With its double-helix structure, DNA is coiled like a spring. A biophysicist grabs the ends of a DNA strand with optical tweezers and stretches it 26µm producing 1.2pN- tension in the strand. What's the DNA's spring constant?
  21. BIO 12

    BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A
  22. Biology

    What evidence did Watson and Crick use to determine that DNA is a helix? Is there another cellular macromolecule that can assume a helical shape?
  23. biology

    Is the tertiary structure of a protein the bonding together of several polypeptide chains by weak bonds? I Know tehre are weak bonds invovled by everything I looke at shows single chains. Any kind of bonding can contribute to the tertiary structure of
  24. biology

    Can someone please describe what a double helix looks like? I think it looks like fusilli pasta. Is this correct? I'm having a lot of trouble understanding what DNA looks like. Please help, thank you. I am visually impaired by the way.
  25. Calculus (Arc Length)

    Consider the helix parametrized with the vector equation r(t)=cos t i+ sin t j + t k. The length L of the helix between the points (1,0,0) and (1,0,6π) is equal to aπ. What is the value of a^2?
  26. Biology

    DNA can copy itself easier than RNA because? A. its a double helix B. polymer of nucleotide C. its confined to nucleus D.its supported by histone proteins I have no idea
  27. Science

    DNA can copy itself easier than RNA because? A. its a double helix B. polymer of nucleotide C. its confined to nucleus D.its supported by histone proteins I have no idea
  28. biology

    A human cell has 10 ^14 cells and each cell has about 6.4 x 10 ^9 nucleotide pairs of DNA. What is the length, in cm, of double helix that can be formed from the total amount of DNA in a human individual?
  29. Biochemisty

    The DNA alpha-helix structure has 566900 complete turns. The average molar mass of one base pair of nucleotides in DNA is approximately 469 g/mol. If the spacing between successive base pairs is about 0.69 nm, and a complete turn in the helical structure
  30. Physics

    The two strands of the helix-shaped DNA molecule are held together by electrostatic forces as shown in the Figure 16-44 in the textbook. Assume that the net average charge (due to electron sharing) indicated on H and N atoms is 0.2e and on the indicated C
  31. biology - dna

    If a DNA double helix is gradually heated, which bonds in the molecule will break first (are the weakest)? A. bonds between the nitrogenous bases B. bonds between the bases and the sugars C. bonds between the sugar and phosphate within a nucleotide D.
  32. chemistry

    The human body is said to contain approximately 50.0 grams of DNA in the entire body. If the number of nucleotides in ONE STRAND of DNA is approximately 3.0 x 106, and the average molar mass of a nucleotide is 327 g/mol, what is the average molar mass of
  33. Chemistry

    The human body is said to contain approximately 50.0 grams of DNA in the entire body. If the number of nucleotides in one strand of DNA is approximately 3.0 x 10^6, and the average molar mass of a nucleotide is 327 g/mole, what is the average molar mass of
  34. biology

    1. The table in Figure 12-3 showes the results of measuring the percentages of the four bases in the DNA of several different organisms. Some of the values are missing from the table. Based on Chargaff's rule, the percentages of guanine bases in chicken
  35. genetics

    Antiparallel means that: A.the two polynucleotide chains run in opposite directions. B.each DNA molecule consists of one old and one new strand. C.opposite strands are held together by base pairing. D.the helix twists to the right. E.there is complementary
  36. chemistry

    The total mass of DNA in the body is 50.0 g. If the number of nucleotides in ONE STRAND of DNA is approximately 3.0 x 106, and the average length of a single nucleotide is 0.34 nm, what is the length (in km) of one strand of DNA when it is stretched out to
  37. BIOLOGY

    WHEN A DNA MOLECULE IS COPIED TO MAKE ANOTHER DNA MOLECULE, WHICH STATEMENT BEST DESCRIBES THE RESULTING STRANDS? A. ONE DOUBLE STRANDED DNA MOLECULE IS THE ORIGINAL AND THE OTHER A NEW COPY B. BOTH RESULTING STRANDS ARE ENTIRELY MADE OF NEW DNA BASED ON
  38. Biology

    17. When errors in nucleotide sequencing occur, a. DNA polymerases replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the
  39. Biology

    17. When errors in nucleotide sequencing occur, a. DNA polymerases replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the
  40. Genetics, HELP!!!

    Planet X, a recently discovered planet, contains life forms that have double-stranded DNA as the genetic material. The DNA on Planet X is transcribed into RNA which is translated into protein. Planet X DNA contains only two bases: guanine (G) and cytosine
  41. Chem

    I'm supposed to pick three that are true, and my personal guesses are 2, 3 and 6. I'd love to know if these are right and if so, why are they right. If not, could someone possibly lead me in the right direction? 1. Leu-Glu-His-Val-Cys-Lys-Ser is a likely
  42. Biology

    which of the following DNA sequences would likely be the most stable? (only one strand of the helix is shown) A) CCGAGGCCT B) CGTATAGGG C) CCCGGGGCC D) CTAAGCTTT E) ATATATATA I know the answer is c but why is that true?
  43. Biology

    In the DNA helix, a ________ (a bicylic nitrogenous base) is always paired with a __________, (a moncyclic nitrogenous base). This occurs because pairing of two of the same kinds of bases would either cause ____________ in the DNA molecule. a. Pyrimidine,
  44. biology

    The length of DNA HELIX occupied by one nucleotide pair is 3.4 angstroms. What is the length in angstroms of this unknown DNA fragment? How do you calculate Angstroms?
  45. BIOLOGY

    1.What is the function of DNA? 2.Name 3 parts of DNA molecule 3.Describe the shape of DNA molecule
  46. Chemistry (Biochem)

    I'm given two pictures looking down the alpha helices of a coiled coil dimer of alpha-keratin. I'm asked to identify three statements out of the following that are true. My guesses are 2, 3, and 6. 1. Leu-Glu-His-Val-Cys-Lys-Ser is a likely repeat in the
  47. Biology

    9. A molecule shaped like a spiral staircase (double helix) is a typical of a. deoxyribonucleic acid b. ribonucleic acid c. carbohydrates d. both a and b D 14. Surface area is an important factor in limiting growth cell because a. the cell may become too
  48. Biochem

    Computers English Foreign Languages Health Home Economics Math Music Physical Education Science Social Studies GRADE LEVELS Preschool Kindergarten Elementary School 1st Grade 2nd Grade 3rd Grade 4th Grade 5th Grade 6th Grade 7th Grade 8th Grade High School
  49. AP BIO

    2. Suppose the DNA molecule were composed of six monomers. In addition to the monomers A, T, C and G, two other monomers, O and P, were present. Furthermore, O and P were known to pair only with each other. Which of following statements regarding this kind
  50. Genetics

    Given the following portion of a double stranded DNA molecule, 3’GATCTCGATGTCGAGATC5’ draw the bands as they would appear on a Sanger DNA sequencing gel using the following primer 5’GATCTCGA3’
  51. bio

    Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA
  52. bio

    Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA
  53. bio please help Ms sue

    DNA is copied by an enzyme called DNA (A) __________, and the process of copying DNA is called (B) __________. The two new double-stranded DNA molecules have one strand from the original DNA molecule and one strand from the freshly assembled strand of
  54. Biology

    If we see a DNA sequence in our FASTA file that reads: ATGCCCTTCGGG. What is the corresponding sequence of our double-stranded DNA molecule?
  55. Science!

    How is the structure of an alpha-helix maintained?
  56. Chemistry

    In a double-stranded DNA molecule, the percentage of Guanine can never be more than ___%. Why?
  57. biology (check answer)

    What is different about every nucleotide of a DNA molecule? a) the deoxyribose sugar b) the phosphate group c) the shape of the molecule d) the nitrogen bases it's the nitrogen bases, am i correct?
  58. English

    I forgot to add the following statements. Thank you. 1)Say, for example, a bit of a DNA molecule has a string of nucleotides in the order CCGCAG. Reading three “letters” at a time, CCG stands for the amino acid glycine. CAG stands for the amino acid
  59. Biology

    1. How many base pairs are in a full turn or twist of a DNA molecule? 2. Name the complementary base pairs on DNA. A-T; G-C are the pairs, you name them. there are 10 1/2 base pairs for a full twist in DNA How does the nucleotide sequence in one chain of
  60. Science

    The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies can be be made directly from the DNA I'm pretty
  61. Biology

    Which of the following statements regarding DNA and RNA is true? DNA can melt while RNA cannot. DNA is resistant to alkaline hydrolysis while RNA is not. DNA contains phosphodiester bonds while RNA does not. DNA can form double helices while RNA cannot.
  62. biology

    1. What are the three parts that make up a nucleotide? 2. What is the sugar found in DNA? 3. What are the four different bases found in DNA nucleotides? 4. What two parts make up the sides of the DNA “ladder”? 5. What holds the sugars and the
  63. Physics

    A molecule of DNA (deoxyribonucleic acid) is 2.03 µm long. The ends of the molecule become singly ionized: negative on one end, positive on the other. The helical molecule acts like a spring and compresses 1.13% upon becoming charged. Determine the
  64. Physics

    A molecule of DNA (deoxyribonucleic acid) is 2.01 µm long. The ends of the molecule become singly ionized: negative on one end, positive on the other. The helical molecule acts like a spring and compresses 0.75% upon becoming charged. Determine the
  65. physices

    A molecule of DNA (deoxyribonucleic acid) is 2.22 µm long. The ends of the molecule become singly ionized: negative on one end, positive on the other. The helical molecule acts like a spring and compresses 0.95% upon becoming charged. Determine the
  66. biology

    Will someone please check my answers? 1. Which process results in an individual inheriting the incorrect number of chromosomes? a.)mutation b.)nondisjunction
  67. Chemistry

    What chemical feature in the protein dictates the local secondary structure? α-helix β-pleated sheet random coils amino acid sequence pH hydrogen bonding
  68. Biology (check answer)

    Transcription is similar to DNA replication in all of the following ways except: a) the DNA strands unzip b) the polymerase enzyme is involved c) complementary bases are paired up d) a new strand of mRNA is built from the existing DNA molecule is it d?
  69. science-important!

    I really need to make sure this is correct for tommorow please help! The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA
  70. science-important!

    I really need to make sure this is correct for tommorow please help! The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA
  71. calculus

    At what points does the helix r = sin(t), cos(t), t intersect the sphere x 2 + y 2 + z 2 = 37? (Round your answers to three decimal places. Enter your answers from smallest to largest z-value.)
  72. Calculus

    At what points does the helix r = sin(t), cos(t), t intersect the sphere x^2 + y^ 2 + z^2 = 26? (Round your answers to three decimal places. Enter your answers from smallest to largest z-value.)
  73. Biology

    9. a molecule shaped like a spiral staircase (double helix) is a typical of a. deoxyribonucleic acid b. ribonucleic acid c. carbohydrates d. both a and b D? 10. ATP is important to living organisms because it a. stores hereditary information b. stores
  74. Biology

    9. a molecule shaped like a spiral staircase (double helix) is a typical of a. deoxyribonucleic acid b. ribonucleic acid c. carbohydrates d. both a and b D? 10. ATP is important to living organisms because it a. stores hereditary information b. stores
  75. Biology(Anatomy&Physiology)

    1)How many covalent bonds does it take to satisfy the carbon atom? 2)In the body, carbohydrates are stored in the form of: 3)Name the portion of an enzyme that attaches to the substrate. 4)The coiling of the protein chain backbone into an alpha helix is
  76. Science

    what does DNA stand for? What is a gene? Where in the cell are chromosomes located? what two scientists established the structure of DNA? DNA is sometimes descrived as twisted ladder. What is this shape called? What forms the backbone of DNA? What forms
  77. chemistry

    The electron pairs in a molecule of NH3 form a tetrahedron. Why does the NH3 molecule have a trigonal pyramidal shape rather than a tetrahedral shape? Explain your answer. PLEASE HELP
  78. Chem answer check

    Do these look right? What shape does an ammonia (NH3) molecule have?trigonal pyramidal In a tetrahedral molecule, how many unshared pairs of valence electrons does the central atom have? none In a polar bond, electrons are? completely transferred What
  79. Science

    After replicated a DNA molecule with two strands three times, how many molecules of DNA are formed? Is eight the correct answer?
  80. Biology

    what properties/features of DNA allow DNA to have uniformity and be a universal molecule?
  81. Biology

    Kay so these are the strands of DNA 5' C C A G T A G T T 3' 3' G G T C A T C A A 5' Let's say the DNA molecule above were the parent strand of DNA. when the strands are split for replication, which strand would be the template for the leading strand? And
  82. Biology

    For the DNA sequence given below, write the complementary DNA sequence that would compliment the double-strand DNA 3'--ATTGCTTACTTGCATGGTACCTCTAGCGTTTAGGC--5'
  83. electrostatic physics

    An uncharged molecule of DNA (deoxyribonucleic acid) is 2.15 m long. The ends of the molecule become singly ionized so that there is a charge of −1.6 × 10^−19C on one end and +1.6 × 10^−19C on the other. The helical molecule acts like a spring and
  84. calculus

    A 160-lb man carries a 25-lb can of paint up a helical staircase that encircles a silo witha radius of 20 ft. If the silo is 90 ft high and the man makes exactly three complete revolutions, how much work is done by the man against gravity in climbing to
  85. living environment

    What is the name for the DNA molecule that would result if the two pieces of DNA were joined together?
  86. Biology

    What is the basic unit of information in a DNA molecule? In an RNA molecule? In a polypeptide?
  87. Biochemistry

    Two molecules of DNA are the same size, but differ in base composition. One molecule contains 20 % (A + T) while the other contains 60 % (A + T). Which molecule has the higher T m? Why?(The m is a subscript of T) I'm not sure what T m is..or how to
  88. bio

    The most common protein secondary structures (the alpha helix and beta conformation) are stabilized primarily by A. ionic bonds B. hydrogen bonds C. disulfide bonds D. van der Waals interactions E. hydrophobic interactions
  89. Java programming

    List all overloading methods (including constructors) in this coding.. public class Circle { private double radius; private String colour; public Circle() { radius = 0; colour = ""; } public Circle (double r) { radius = r; } double getRadius() { return
  90. Bio

    17. When errors in nucleotide sequencing occur, a. DNA polymerases replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the
  91. DNA

    Do the two DNA double helices following DNA replication have the same, or a different, composition?
  92. Biology - Genetics

    I have not been able to find any more in depth websites/answers for this question. DNA is considered to be a relatively stable molecule. What is it that gives the molecule its stability when the hydrogen bonds between the nitrogen bases are so easily
  93. Genetics

    A viral DNA is analyzed and found to have the following base composition, in mole percent: A = 32, G = 16, T = 40, C = 12. What can you immediately conclude about this DNA? a stretch of double stranded DNA contains 1000 base pairs and its base composition
  94. Science

    How do you think a scientist might figure out a person’s identity from bones? My answer I think that depending on the shape and size of the bones are different for every person like you DNA. This is how they know who you are. it is also possible that
  95. Biology

    17. When errors in nucleotide sequencing occur, a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA
  96. Biology

    17. When errors in nucleotide sequencing occur, a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA
  97. biology

    Read the scenario. Loretta has a sample that contains a mixture of different DNA molecules. She would like to separate them by size to help her determine the length of each molecule. Which technique should she use? A- PCR B- Gel electrophoresis C- DNA
  98. Biology

    When errors in nucleotide sequencing occur,? a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide. b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one. c. purines replace pyrimidines in the DNA
  99. Chemistry

    I have answered this as best as I can please can you check and help me with the ones I don't have a clue about? Thank you Which of the moelcules listed below possesses a permanent dipole? Think about the shape of the molecule and look at the
  100. Biology DNA

    What are the components of DNA and how is the backbone of a single strand of DNA constructed? I put the components as nitrogenous base, deoxyribose molecule, and a phosphate group...I don't know the second part of the question :/