1. Algebra

    Order from least to greatest: 2.1, 3/5, -0.7, 7/10

    asked by Raven on May 25, 2015
  2. math

    Order from least to greatest 7/12,0.75,5/6

    asked by Lupe on September 2, 2015
  3. math

    order these from least to greatest,5/9,2/7,1/8

    asked by sahar on November 7, 2016
  4. math

    0.5, 3/5, 1 3/4, 0.9 in order from least to greatest

    asked by Jake on February 21, 2013
  5. Math

    Order from least to greatest. -4, -3.9, - 2/9, 2/11

    asked by Jane on October 22, 2013
  6. math

    What is the order of 1.5 x 10^3, 1.4 x 10^-1, 2 x 10^3, and 1.4 x 1-^-2 from least to greatest?

    asked by Daniel on November 15, 2010
  7. Python: Named tuples

    I've been trying to print a list of the book titles within the named tuple in alphabetical order, but I don't know what I'm doing wrong. I've set up my named tuple as so: Book = namedtuple('Book', 'author title genre year price instock') # Book attributes:

    asked by Student on January 23, 2014
  8. Anatomy and Physiology

    Which one of the following groups of structures is involved in regulating calcium levels? A. Parathyroid, thymus, intestines, kidneys, and bones. B. Parathyroid, bones, intestines, kidnesy, and adrenal glands. C. Thyroid, parathyroid, bones, intestines,

    asked by Kay on February 21, 2009
  9. physics

    A space traveler weighs 635 N on earth. What will the traveler weigh on another planet whose radius is three times that of earth and whose mass is twice that of earth?

    asked by Donald on October 4, 2012
  10. physics

    A space traveler weighs 620 N on earth. What will the traveler weigh on another planet whose radius is three times that of earth and whose mass is twice that of earth?

    asked by Anonymous on January 30, 2012
  11. Statistics

    The mean length of the first 20 space shuttle flights was about 7 days with a standard deviation of about 2 days. Using Chebychev's theorem, at least how many of the flights lasted between 3 and 11 days.

    asked by Kenneth on November 16, 2013
  12. English

    I revised the sentences again. Now I really need your final check At the end of their two-year project students will be able to 1) master the basic linguistic structures to operate in a work/scientific environment (I don't know how to express it) 2) be

    asked by Henry2 on February 1, 2012
  13. Accounting

    Need help with this bank reconciliation...this is actually for a job and I am forgetting everything about accounting because I am nervous. BANK RECONCILATION ============================================== On Aug 14th, One of our Partner's ( Compuville )

    asked by Tiffany on November 17, 2010
  14. Science help

    Will someone please check my work for me? Molecules involved in a chemical reaction must meet to react. What is this concept called? entropy enthalpy collision theory

    asked by Napolian 2 on June 21, 2012
  15. Math

    I need to research the following fractal-related topics and find enough information to write five sentences. a. a Peano curve b. the devil's staircase c. self-similarity d. space-filling curve I also need to find out how the concept of fractals is applied

    asked by Anna on April 7, 2009
  16. Physics

    A cricket ball rotates at 1800 rev/min as it travels through the space in a straight line at 160 km/hr. How many times does it revolve after traveling 20m? Can someone confirm with me if 13.5 revolutions in 20m is right. That's the answer i got too. If

    asked by Yoyo on August 7, 2015
  17. science

    2) Which is not an example of matter? A. water B. air(i think it this one) C. gold D. sound 3) The amount of space an object occupies is called its ..... A. volume(i think it this one) B. mass C. electricity D. gravity 4) Atoms in a molecule are joined

    asked by eduarda on December 12, 2014
  18. Physics

    (A) Identify how the gravitational potential energy changes as a shuttle takes off from the launch pad. (b) Explain the consequences to the space craft and its occupants if the shuttle is undergoing re-entry, and the angle of re-entry is significantly

    asked by Alfred on August 31, 2009
  19. Physics

    Which of the following exhibits parabolic motion? a. a stone thrown into a lake b. a space shuttle orbiting Earth c. a leaf falling from a tree d. a train moving along a flat track what is parabolic motion? which would be a good choice? thanks alot for ur

    asked by y912f on February 5, 2009
  20. Chemistry

    The space probe Pioneer 11 was launched April 5,1973, and reached Jupiter in December 1974 traveling a distance of 998 million km. How long did it take an electromagnectic signal to travel to earth from Pioneer 11 when it was near Jupiter. Where do I

    asked by Lauren on November 1, 2007
  21. physics! description explanations

    The graph at the right is a positive vs. Time graph for the motion of an object moving along a horizontal (x) axis For each of the 8 1-second time intervals, describe the displacement, instantaneous velocity (+/- and whether the velocity is increasing or

    asked by Lina on January 6, 2016
  22. English

    I have a doubt concerning the following structure: The Asiatic lions are in danger of extinction, as are the Asiatic cheetahs. (like the Asiatic cheetahs is also possible?) Where is this rule explained: as + verb + word like + word

    asked by Henry2 on November 7, 2011
  23. College algebra!

    For the linear function f(x) = 5x + 3 (a) Determine the slope and y-intercept (b) Use the slope and y-intercept to graph the linear function. (c) Determine the average rate of change of the function (d) Determine whether the linear function is increasing,

    asked by Jenn on March 15, 2013
  24. college

    The proposed developer employed only certified programmers. Over the past five years they have redesigned more than 50 databases for local businesses. They will add innovative new functionalities to our system, while increasing the efficiency of our

    asked by Anonymous on January 28, 2016
  25. math-urgent

    Sample space ={1,2,3,4,5} p(1)=0.1, p(2)=0.2 and p(3)=p(4)=0.05. Assume that A={1,3,5} and B={2,3,4}. Find p(5). Find p(A^c). I need help with this question. It is a probability question. please help.

    asked by Temmick on April 7, 2014
  26. science

    How are moon observations from space different from moon observations made on Earth? I think there is no deifference.

    asked by Nour on July 29, 2015
  27. science

    When salt (NaCI) is added to water, it disassociates into Na and Cl-ions. Which of the following types of chemical bond is present in a salt molecule? A. Covalent bond B. Ionic bond C. Hydrogen bond D. Disulfide bond i think its B An example of active

    asked by manny on October 25, 2015
  28. Maths

    A hollow cube of internal edge is 22cm is filled with spherical marbles of diameter 0.5cm and it is assumed that 1/8 space of the cube remain unfilled.Then the number of marbles that the cube can accomodate is?

    asked by Princ on February 8, 2016
  29. RE

    i have to write a poem about 'your expression of the vastness of space/universe as a poem. i have all the ideas in my head about the universe being incredibly vast. but im rubbish at writing poems. Can anyone help or find a useful website that has a poem

    asked by Nabiha on February 10, 2009
  30. help math

    a partial moves along the x-axis so that its velocity at time t, for 0< = t = < 6, is given by a differentiable function v whose graph is shown above. The velocity is 0 at t=0, t=5, and the graph has horizontal tangents at t=4. the areas of the regions

    asked by dave on May 20, 2008
  31. Calc

    a partial moves along the x-axis so that its velocity at time t, for 0< = t = < 6, is given by a differentiable function v whose graph is shown above. The velocity is 0 at t=0, t=5, and the graph has horizontal tangents at t=4. the areas of the regions

    asked by sammy on May 19, 2008
  32. Calc

    "Let f(x,y)=2(x^2)y-(y^3)+x-4. a) Find the local linearization of f at (3,1) b) Compute the directional derivative of f at (3,1) in the direction towards the point (-2,3). At (3,1), is the function f increasing or decreasing in the direction towards the

    asked by Brittany on March 1, 2011
  33. IT

    Use Microsoft® Project to develop a Work Breakdown Structure (WBS) for your project defined in Week 2. Include a 100- to 150-word description of how and why you would use a WBS in a project. · Post your completed WBS and my project is on upgrading a

    asked by Becky on May 27, 2009
  34. A&P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? 1A. What is its mRNA nucleotide sequence? AGCCCGAUGUUUUGUUUAGUUGCCCCGAGCGUUUGUUUAUUUGCC 1B. Indicate the product

    asked by ISSY on June 8, 2013
  35. finance

    You were hired as a consultant to Giambono Company, whose target capital structure is 40% debt, 15% preferred, and 45% common equity. The after-tax cost of debt is 6.00%, the cost of preferred is 7.50%, and the cost of retained earnings is 12.75%. The firm

    asked by adam on April 2, 2011
  36. chemistry

    I have to draw the QMM of CL2C2. For the Lewis structure i think that the two C ayoms form a triple bond and the Cl atoms form single bonds. Therefore i think that the central C atom hybridizes into sp. if this is correct, my question is how do i know

    asked by lyne on April 29, 2009
  37. Statistics

    The Tyco Video Game Corporation finds that it is losing income because of slugs used in its video games. The machines must be adjusted to accept coins only if they fall within set limits. In order to set hose limits, the mean weight of quarters in

    asked by Lizzy on July 22, 2015
  38. Calc

    analaze the graph of y = 2/ (x^2-9) y-intercepts: ____________________ vertical asymptotes: ____________________ horizontal asymptotes: ____________________ increasing intervals: ____________________ decreasing intervals: ____________________ relative

    asked by Jordan on January 24, 2012
  39. Accounting

    Can someone show me this bank reconciliation? On Aug 14th, One of our Partner's ( Compuville ) cash book showed a debit balance of $4,000.00. His bank statement showed a balance of $4,270.00. On comparison the following were found: * check issued amounting

    asked by Lee on January 19, 2013
  40. Language Arts ~CHECK MY WORK PLEASE~

    1. What can you predict about the poem by previewing the title, subtitle, and first line of the poem "In response to executive order 9066"? a.) It will be a letter to the Japanese-American citizens in which they are told they must leave their homes. b) It

    asked by Jenny on February 5, 2014
  41. HR

    . Which of the following is not an advantage of a balanced scorecard? A. Communicating a balanced scorecard helps employees understand the organization's goals and how they might contribute to these goals. B. A balanced scorecard links external pay rates

    asked by blue on August 3, 2018
  42. math

    Scott, Mike, and Holly shared an order of French fries. Scott ate x fries. Mike ate one more than twice the amount of fries that Scott ate. Holly ate 5 fewer fries than Scott did. If there were 6 fries left, how many fries were in the order? a. x-5 b. x c.

    asked by Tomas on November 14, 2013
  43. home economics

    The economist for the Grand Corporation has estimated the company’s cost function, using the times series data to be TC=50+16Q-2Q2+0.2Q3 a. Plot this curve for quanties 1 to 10 b. Calculate the average total cost, average variable cost and marginal cost

    asked by Anonymous on February 23, 2008
  44. econ

    The economist for the Grand Corporation has estimated the company’s cost function, using the times series data to be TC=50+16Q-2Q2+0.2Q3 a. Plot this curve for quanties 1 to 10 b. Calculate the average total cost, average variable cost and marginal cost

    asked by Anonymous on February 23, 2008
  45. accounting 220

    Final Project: Final Project • Resources: Appendix A • Due Date: Day 7 [post in the Individual forum] • Write a 700-1,050 word paper, using APA guidelines, based on following scenario. You want to start your own business. You found an investment

    asked by Amber on February 4, 2010
  46. Management & Economics

    a producer of light bulbs claims to have the folllowing production function: Q=10L*G. a) what is the marginal product of labor? or glass? b)Draw the relavant isoquant map and isocost line if the cost of labor is $4 per work-hour and the cost of glass is $4

    asked by Lisel on September 17, 2011
  47. science

    Which of the following would increase the effect of tides on Earth (high tides get higher, low tides get lower) - slowing the rate of rotation of the Moon. - increasing the rate of rotation of the Moon. *** - decreasing the distance between the Earth

    asked by ally on September 22, 2017
  48. science

    Which of the following would increase the effect of tides on Earth (high tides get higher, low tides get lower) - slowing the rate of rotation of the Moon. - increasing the rate of rotation of the Moon. *** - decreasing the distance between the Earth

    asked by ally on September 23, 2017
  49. Biology

    In detail can someone please explain to me how cooking eggs makes them safe to eat in connection with enzymes Thank you I understand that enzymes are killed because of the heat as it is a factor in destroying the enzymes activity but how does this explain

    asked by carly on October 24, 2010
  50. math

    Below is a function the represents the sales for tickets to battle of the Bands Phoenix Music Festival. Student council needs students to buy ticket early in order to book a venue. In order to do this they made a piece scale as follows, where x is the days

    asked by dai on March 9, 2016
  51. math

    Below is a function the represents the sales for tickets to battle of the Bands Phoenix Music Festival. Student council needs students to buy ticket early in order to book a venue. In order to do this they made a piece scale as follows, where x is the days

    asked by Dai help help! on March 9, 2016
  52. Social studies

    In which way are the governments of Saudi Arabia and Oman most similar? Their rulers are related. They both have absolute monarchies. They have newly written constitutions. Their structures descend from Ottoman caliphs. 14. What do young Israelis and young

    asked by Anonymous on March 12, 2015
  53. Us history please help

    The] said Cooper Hughs Freedman with his wife...are to work on said farm and to cultivate forty acres in corn and twenty acres in cotton, to assist in putting the fences on said farm in good order and to keep them so and to do all other work on said farm

    asked by Anonymous on April 9, 2018
  54. Geometry

    Jason designed an arch made of wrought iron for the top of a mall entrance. The 11 segments between the two concentric circles are each 1.25 m long. Find the total length of wrought iron used to make the structure. Round the answer to the nearest meter.

    asked by Brittany on November 20, 2013
  55. Analytical Chemistry

    Show the predominant form of the amino acid tyrosine at pH=13.9 and ph=7.8. Be sure to include the proper number of hydrogens on heteroatoms and the correct formal charges on atoms. I calculated the pka values for COOH (pka=2.41) NH3 (pka=8.67), and OH

    asked by Sam on February 26, 2013
  56. History

    In four, explain how the structure of the First Amendment supports equal weight of each freedom it guarantees. "Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof; or abridging the freedom of

    asked by Ari on January 8, 2018
  57. math algebra

    The sum of 2 numbers is 400.If the first number is decreased by 20% and the second number is decreased by 15% then the sum would be 68 less than 400.Find the numbers after the decreasing.

    asked by someone please help!!! on May 27, 2017
  58. Biology

    MEIOSIS 1)name the process unique to meiosis that occurs during bivalent formation that may increase genetic diversity? 2)how are sister chromatic made and what is the structure that holds them together? 3)what do we call package of genetic information

    asked by sk on February 22, 2016
  59. mechanics

    A space aircraft is launched staight up.The aircraft motor provide aconstant acceleration for 10 second ,then it stops.the aircraft's altitude 15 second after launch is 2 km.ignore air friction.what is the acceleration and the maximum speed reached in

    asked by shone on April 4, 2013
  60. Physics (Electric fields and Coulomb's Law)

    I need help with this question please. An ion harvester is scouring deep space for isolated xenon (Xe+) ions. A xenon ion is singly ionized, and has a charge of +e. If the field meter reads 0.000000202 N/C, how far away is it from the ion? _________ m

    asked by Kathy on April 21, 2013
  61. UNDERSTANDING OBSERVATION AND BEHAVIOR

    The Child Development Checklist is an observation tool that A. includes space to record non-objective data. B. omits references to children's emotions. C. focuses on sequences of child development. D. can only be used by one observer for the same child.

    asked by Anonymous on April 5, 2013
  62. PRE-CALC

    A number is selected at random from the set {2, 3, 4, … ,10}. Which event, by definition, covers the entire sample space of this experiment? A) The number is greater than 2. B) The number is not divisible by 5. C) The number is even or less than 12. D)

    asked by Shawna on March 18, 2014
  63. ECE

    the child development checklist is an observation tool that? A.can only be used by one observer for the same child B.omits references to childrens emotions. C.includes space to record non-objective data. D.focuses on sequences of child development

    asked by Leeann on December 7, 2012
  64. Chemistry (equilibrium)

    C2H6(g) C2H2(g) + 2 H2(g) The ΔH° for the reaction above is +312 kJ. The system is initially at equilibrium. In which direction will the reaction shift in each of the following situations? e) The temperature is decreased. g) He is added at constant

    asked by Paige on September 10, 2016
  65. chemisrty

    Rank following acids frommost to least acidic: hydrocyanic acid (HCN) Ka = 6.2 × 10−10 hypoiodous acid (HOI) Ka = 2 × 10−11 chlorous acid (HClO2) Ka = 1.2 × 10−2 acetic acid (CH3COOH) Ka = 1.8 × 10−5 1. HOI > HClO2 > CH3COOH > HCN 2. CH3COOH >

    asked by susan on June 8, 2014
  66. Calculus

    An object is traveling along the x axis so that its speed is given by v(t)=t^2-7t+10 m/s. (a) Find the times when the object is at rest. (b) Find the acceleration at both of these times. Interpret the acceleration in terms of the motion of the object, ie

    asked by Mike on May 15, 2013
  67. Science

    Which of the following is a way to improve the efficiency of a heat engine? increase Qh reduce Qh reduce Wnet increase Qc A What are the energies associated with atomic motion called? kinetic energy potential energy bond energy internal energy D A 0.10 kg

    asked by Lena on January 23, 2012
  68. physic

    Jules Verne in 1865 proposede sending men to the moon by firing a space capsule from a 220-m-long cannon with final velocity of 10.97 km/s. what would have beed the unrealistically large accelerationexperienced travels during launch? compare your answer

    asked by Laura on September 7, 2009
  69. Geography

    which adaptation to southeast asia's geography has been most successful? a)skyscrapers allow everyone to have plenty of space to live and work. b) Earthquake safety alerts have saved many lives during earthquakes

    asked by Lola on March 2, 2016
  70. Anatomy

    Can someone help me answer these 4 questions I have? Skeletal muscle cell are long and do not branch. Why is this the best structure for this type of muscle? Why does having many long, branched dendrites and axons beneficial for nervous tissue? How does

    asked by John on January 22, 2009
  71. anthropology

    what is the family structure of chinese families and Indian families. Thank you for using the Jiskha Homework Help Forum. Try these sites: 1. http://www.nira.go.jp/publ/houko/i980116.html 2. http://en.wikipedia.org/wiki/Chinese_culture 3.

    asked by singh on August 10, 2007
  72. english

    I need to know how to find the plot in a poem. The poem is "The Passionate Shepherd to His Love" by Christopher Marlowe http://en.wikipedia.org/wiki/Plot_%28narrative%29 Scroll down to the list in Typical plot structure and see how the events in this poem

    asked by april on April 13, 2007
  73. Grammar

    True or False Is the following sentence properly functuated. The young appearing patient went to the doctor's office. Answer is FALSE My question is WHY? - Is it BAD sentence structure - we have ruled out that the apostrope is CORRECT. Should there be a

    asked by Leslie-To:Writeacher on June 18, 2011
  74. English

    Hello. I will be very grateful if you check the sentences: 1)"Do you think students are not allowed to use dictionaries while writing tests?" 2)"Do you think using dictionaries is not allowed while writing tests?" Do they sound natural and standard

    asked by Nalmi on May 21, 2014
  75. chemistry

    what is the molecular geometry of trans-difluroethylene: trans-C2H2F2? i want to say it is a tetrahedral because it has four atoms and no lone pairs, but im not sure. the bond angles of this is 109.5 and that is is the bond angles for tetrahedrals so is it

    asked by john on May 24, 2008
  76. MATERIAL SCIENCE

    1. Calculate the theoretical density of Barium metal barium 2. Calculate the theoretical densities and packing factor of barium zirconate (BaZrO3), and barium cerate (BaCeO3), both of which form the perovskite structure

    asked by MANFRED on February 1, 2016
  77. Separation of Racemate

    You have the racemate of a material. This material has an acid group as part of its structure. You also have a chiral base available. Design an experiment to separate the racemate into pure enantiomers. I have no ideas about this experiment and I need some

    asked by Josh on October 8, 2014
  78. Basic Finance

    Suppose we observe the following rates: 1R2= 8%, 1R2= 10%. If the unbiased expectations theory of the term structure of interest rates holds, what is the 1-year interest rate expected one year from now, E(2r1)?

    asked by Maria on April 1, 2016
  79. Grammar

    Determine if the following sentence is correct or incorrect. The patient had a difficult time recovering the wouldn's dressing. ANSWER: incorrect WHY - we ruled out that the ' is correct. Should there be a comma after time - or just bad sentence

    asked by Leslie-To:Writeacher on June 18, 2011
  80. Linear Algebra

    4 points A,B,C and D are situated in a 3-dimensional space. In a certain spot, the coordinates of A, C and D are known: A(1,1,1) C(2,0,1) D(0,3,0) The coordinates of the barycentre of {A,B,C} are: (4/3, 1/3, 4/3). a) Determine the coordinates of point B in

    asked by Raf on May 1, 2012
  81. Linear Algebra

    4 points A,B,C and D are situated in a 3-dimensional space. In a certain spot, the coordinates of A, C and D are known: A(1,1,1) C(2,0,1) D(0,3,0) The coordinates of the barycentre of {A,B,C} are: (4/3, 1/3, 4/3). a) Determine the coordinates of point B in

    asked by Raf on April 30, 2012
  82. Science

    Why would people need to travel to the moon? what data do they collect on the moon? I am doing a space project, I choose the moon, but I don't know why I would travel there.....

    asked by Princess Anna on December 29, 2013
  83. Finite Math

    Let A and B be two events in a sample space S such that P(A) = 0.5, P(B) = 0.6, and P(A intersection B) = 0.15. Find the probabilities below. Hint: (A intersection Bc) union (A intersection B) = A. (a) P(A|Bc) ________ (b) P(B|Ac) ________

    asked by Seth on November 20, 2014
  84. Physics?

    Which of the following is a possible application of a centrifuge? (More than one answer may be correct.) Test astronaut’s tolerance for high accelerations Produce even mixtures of particles of different densities Separate human blood cells Speed

    asked by anonymous on January 5, 2018
  85. science

    what are tow types of environment present in every habitat? I'm not sure what you are asking. The geological the the climate aspects are always present. Is this what you want? I hope this helps. If not, repost your question in more specific terms. Thanks

    asked by jessica on November 30, 2006
  86. relativity

    Show that the following process is dynamically inpossible: A single photon in empty space is transformed into an electron and a positron, each with rest mass m(e).Explain in detail, How can this this process be made possible? In this case, what is the

    asked by walter on June 7, 2011
  87. Physics

    A rotating space station has radius 1270 m, measured from the center of rotation to the outer deck where the crew lives. What should the period of rotation be if the crew is to feel that they weigh one-half their Earth weight? I got 101.1 seconds... is

    asked by Brandi on June 3, 2012
  88. childhood

    The major emphasis of movement programs for young children is the development of concepts. Wich of the following three major categories are they broken into? A Body,space, and time B What,who,where C Awareness, knowledge,and understanding D Movement, skill

    asked by Abbie on January 15, 2010
  89. childhood

    The major emphasis of movement programs for young children is the development of concepts. Wich of the following three major categories are they broken into? A Body,space, and time B What,who,where C Awareness, knowledge,and understanding D Movement, skill

    asked by Abbie on January 15, 2010
  90. Physics

    Just reposting. A cricket ball rotates at 1800 rev/min as it travels through the space in a straight line at 160 km/hr. How many times does it revolve after traveling 20m? Can someone confirm with me if 13.5 revolutions in 20m is right. That's the answer i

    asked by Yoyo on August 8, 2015
  91. Computer programming

    Sorting is a common operation used in programming. Although languages such as Visual Basic 2008 offer built-in methods for sorting, other languages such as C do not support such a method. In order to be a programmer you should be able to implement such

    asked by Brenda on August 17, 2010
  92. Health

    Can you please check these sentences? Thank you, Writeaacher! 1) You must be respectful of your classmates and of your teachers. You should stand up when teachers (or your teachers?) enter the classroom. 2) You mustn't drink or eat during lessons but you

    asked by Jane on May 15, 2012
  93. Grade 12 Biology

    I am confused about this question, and can't find anything on the internet, anyone care to explain? Why is the tertiary structure of an enzyme, such as amylase, so important? An enzyme is a protein, so is it really asking why is this stage important? And

    asked by MileyCyrus on February 18, 2008
  94. english

    Which of the following correctly defines blank verse? A. poetry with no structure or rhyme B. a type of long poem often used for plays C. a type of rhymed poetry Shakespeare uses throughout his plays D. unrhymed verse written in iambic pentameter i think

    asked by Jack on May 24, 2016
  95. english

    Which two elements define a story’s setting? a. geographical location b. character descriptions c. time and weather conditions d. plot structure e. dialogue and action The setting is the time and place definitely A and c? never thought about weather

    asked by marie on March 12, 2017
  96. English

    Which of the following correctly defines blank verse? A. poetry with no structure or rhyme B. a type of long poem often used for plays C. a type of rhymed poetry Shakespeare uses throughout his plays D. unrhymed verse written in iambic pentameter D?

    asked by quick help needed on May 29, 2016
  97. Physics

    A 46% efficient device uses chemical energy to generate 570J of electric energy. 1. How much chemical energy is used? 2. A second device uses twice as much energy to generate half as much electric energy. What is its efficiency?

    asked by Anonymous on December 4, 2012
  98. English

    1. She is fond of scuba diving. 2. She likes scuba diving. 3. She is afraid of snakes. 4. She fears snakes. 5. She is aware of the fact. 6. She knows the fact. (Is each pair the same in meaning? Do you have some more expressions which have the same

    asked by rfvv on June 5, 2017
  99. Chemistry

    How do you find the number of valence electrons in a molecule? Do I need to use the Lewis structure diagram to find out? Please help! I need to the total number of valence electrons for SiH4, H2SO4, CCl4, BF3 and I don't know how!

    asked by Anonymous on February 10, 2010
  100. Physics

    Many people mistakenly believe that the astronauts who orbit the Earth are "above gravity." Calculate g for space shuttle territory, 290 kilometers above the Earth's surface (dashed line in sketch). Earth's mass is 6 1024 kg, and its radius is 6.38 106 m

    asked by Alfonso on October 5, 2013