1. Science

    With reference to the chemical- physical structure of DNA, and the nature and importance of a stable genetic code, describe the major forms of chromosomes mutations; also, describe, using examples: the major categories/types of mutagenic agents and how
  2. Chemistry

    Can you help me with solving this? I don't just want the answer,but how to do it. The average distance between Mars and Earth is about 1.3 108 miles. How long would it take TV pictures transmitted from the Viking space vehicle on Mars' surface to reach
  3. Physics

    A rotating space station has radius 1310 m, measured from the center of rotation to the outer deck where the crew lives. What should the period of rotation be if the crew is to feel that they weigh one-half their Earth weight?
  4. The practice of working with school age children

    One effective way to include children in developing an attractive environment is to ask them A. to describe their bedrooms. B. what color they want their car to be. C. to describe how their mom sets up the house. D. what they would do with an open space.
  5. Physics

    a 1000 kg space craft at 500 m/s is on a collision course with a 400 kg satellite travelling at 700 m/s . Their paths are converging at a 45 degree angle . After the collision they remain locked together. What is the final speed of both satellites? What
  6. Physics

    rotating space station has radius 1380 m, measured from the center of rotation to the outer deck where the crew lives. What should the period of rotation be if the crew is to feel that they weigh one-half their Earth weight?
  7. History

    10. Many geographers, such as Elder, Knopp, and Nast, refer to theories that explain or inform our understanding of sexuality and space as........ A. queer theory B. heteronormative theory C. gender studies D. spatial theory E. modernization theory A
  8. Algebra, Need help with last part.Thank you

    A single card is selected from an ordinary deck of cards. The sample space is shown in the figure below. Find the probabilities. (Enter the probabilities as fractions.) P (two of hearts0 I got 1/52 correct P ( two)I got 4/52 correct P (heart)I am not sure.
  9. chemistry

    space probe Pioneer 11 was lanced April 5, 1973, and reached Jupiter in Dec.1974 traveling a distance of 998 km. How long did it take an electromagnetic signal to travel to earth from pioneer 11 when it was near jupiter?
  10. Physics

    an astronaut throws a ball with mass m to the right with speed v. It strikes the wall of the space station and rebounds, moving left with a speed V/2. What was te magnitude of the impulse of the ball caused by the collision? Any help would be greatly
  11. PHYSICS

    A plane electromagnetic wave moving through free space has an E- field given by E_x=0; E_y=0; E_z=100 sin[8π×〖10〗^14 (t- x/(3×〖10〗^8 ))]. Calculate the corresponding flux density.
  12. Physics

    When the Philae probe landed on Comet 67P, it took approximately 28 minutes for a radio signal to be received at the European Space Operations Centre. Determine the distance (in metres) from the Philae probe to Earth.
  13. chemistry

    If maleic acid could be represented as H2Ma, write the 2 net ionic equations for its reaction with NaOH in the space below (showing the sequential neutralization of each acidic proton): 1)H2Ma +NaOH---->NaMa+H3O 2) What's the second one?
  14. physical science

    How many hours are required for a radio signal from a space probe near the dwarf planet Pluto, 6.00 x 10 (to the 9th) km away, to reach Earth? Assume that the radio signal travels at the speed of light, 3.00 10 (to the 8th) m/s.
  15. science

    about how many diffrent rocks are there Directly from the site I gave you: "The three classes of rocks: the igneous, the sedimentary and the metamorphic — are subdivided into many groups. There are, however, no hard and fast boundaries between allied
  16. Physics

    A spaceship in deep space has a velocity of 4000 km/s and an acceleration in the forward direction of 6 m/s2. What is the acceleration of a ball relative to the spaceship after it is released in this spaceship?
  17. Math

    What is the most precise name for each space figure that has the given properties. 1. four lateral faces that are triangles? 2. three lateral faces that are rectangles? 3.a lateral surface and one circular base?
  18. math

    at the fair, 3/4 of the students wanted to see the space shuttle exhibit,but only 2/9 of theses students wrote down the address to get more nformation. what fraction of the students got the address?
  19. Math

    What is the most precise name for each space figure that has the given properties. 1. four lateral faces that are triangles? 2. three lateral faces that are rectangles? 3.a lateral surface and one circular base?
  20. Math

    A painting shaped like a circle had a diameter of 20 inches. A circular frame extends 2 inches around the edge of the painting. How much wall space does the framed painting need? Use 3.24 for pi.
  21. history

    how is the creation of public policy in Russia different from that in the united states? Russia's president passes public policy through referendums; in united states the president must wait for congress to pass legislation. *** the president of the united
  22. Economics -- HELP!!!

    posted by Angela on Sunday, May 21, 2017 at 12:33am. In the market equilibrium, with a price of $500 there are 2000 apartments. If the government decides to enact a rent control policy, with a maximum price of $400, it reduces the quantity to 1500
  23. world history

    Which statement applies to BOTH the maurya and the Gupta empires? A.Both empires united diverse peoples within their empires. B.Both empires fought bitterly against Buddhism. C.Both empires had a loose goverment structure that gave power to individual
  24. Chemistry

    How will the boiling point of a substance be affected by increasing the atmospheric pressure? How will the boiling point of a substance be affected by decreasing the atmospheric pressure?
  25. Calc

    a partial moves along the x-axis so that its velocity at time t, for 0< = t = < 6, is given by a differentiable function v whose graph is shown above. The velocity is 0 at t=0, t=5, and the graph has horizontal tangents at t=4. the areas of the
  26. help math

    a partial moves along the x-axis so that its velocity at time t, for 0< = t = < 6, is given by a differentiable function v whose graph is shown above. The velocity is 0 at t=0, t=5, and the graph has horizontal tangents at t=4. the areas of the
  27. science

    Which of the following would increase the effect of tides on Earth (high tides get higher, low tides get lower) - slowing the rate of rotation of the Moon. - increasing the rate of rotation of the Moon. *** - decreasing the distance between the Earth
  28. Biology

    In detail can someone please explain to me how cooking eggs makes them safe to eat in connection with enzymes Thank you I understand that enzymes are killed because of the heat as it is a factor in destroying the enzymes activity but how does this explain
  29. algebra

    Decreasing cube. Each of the three dimensions of a cube with sides of length s centimeters is decreased by a whole number of centimeters. The new volume in cubic centimeters is given by V(s) = s3 - 13s2 + 54s -72. a) Find V(10). b) If the new width is s -
  30. math

    A cue shaped box fits exactly around a soccerball with a diameter of 22.28 cm. What percent of the box is empty space? Help understand how to get to the answer, and wat it would be Cube shaped box*
  31. Math

    A rectangular family room has 204 square feet of floor space. If its length is 17 feet, how many feet wide is it? A. 18 B. 12 C. 17 D. 187 E. Not enough information is given. Answer: 204/17=12
  32. geography check

    the atmosphere:A)creayes tides b)has no effect on heat gain or loss c)allows heat to escape quickly D)keeps heat from escaping too quickly into space. i choose b
  33. math

    At Soap ans Suds there are 16 washing machines in a single row with no space between each one.Each washing mashine is 2 feet 5 inches across. What is the total length of the 16 washing machines?
  34. Math

    It is recommended that there be at least 7 square feet of work space for every person in a conference room. A certain conference room is 13' by 16'. Find the maximum number of people the room can accommodate.
  35. physics

    A 1000kg rocket is moving forward at 10m/s in space. A 10,000N force is applied to the rocket for one second from behind. How fast is the rocket now traveling? a. 0m/s b. 10m/s c. 15m/s d. 20m/s
  36. science

    What are the consequences of avoiding stress management? Consider all six dimensions of wellness. Here are some results I have come up with? Is there more? Science and medical studies have substantiated that we can avoid the detrimental outcomes of
  37. Statistics

    The mean length of the first 20 space shuttle flights was about 7 days with a standard deviation of about 2 days. Using Chebychev's theorem, at least how many of the flights lasted between 3 and 11 days.
  38. physics

    A space traveler weighs 620 N on earth. What will the traveler weigh on another planet whose radius is three times that of earth and whose mass is twice that of earth?
  39. physics

    A space traveler weighs 635 N on earth. What will the traveler weigh on another planet whose radius is three times that of earth and whose mass is twice that of earth?
  40. Linear Algebra

    4 points A,B,C and D are situated in a 3-dimensional space. In a certain spot, the coordinates of A, C and D are known: A(1,1,1) C(2,0,1) D(0,3,0) The coordinates of the barycentre of {A,B,C} are: (4/3, 1/3, 4/3). a) Determine the coordinates of point B in
  41. Finite Math

    Let A and B be two events in a sample space S such that P(A) = 0.5, P(B) = 0.6, and P(A intersection B) = 0.15. Find the probabilities below. Hint: (A intersection Bc) union (A intersection B) = A. (a) P(A|Bc) ________ (b) P(B|Ac) ________
  42. Linear Algebra

    4 points A,B,C and D are situated in a 3-dimensional space. In a certain spot, the coordinates of A, C and D are known: A(1,1,1) C(2,0,1) D(0,3,0) The coordinates of the barycentre of {A,B,C} are: (4/3, 1/3, 4/3). a) Determine the coordinates of point B in
  43. algebra (inequalities)

    a weaver spends $420 on supplies to make wall hangings and plans to sell the wall hangings for $80 each. a. write an inequality that gives the possible numbers of (w) wall hangings the weaver needs to sell in order for the profit to be positive b. what are
  44. chemistry

    N2(g) + 3 F2(g) → 2 NF3(g) ΔH° = –264 kJ/mol ΔS° = –278 J/(mol∙K) a. calculate the maximum amount of non-PΔV work that can be accomplished through this reaction at a temperature of 500°C. b. Determine the temperature at
  45. Waves (8th Grade)

    Predict: How resonance can cause earthquakes to do greater damage to some buildings than others. Analyze: If two astronauts were able to go on a space walk without wearing suits. Explain why they would not be able to talk to one another. Describe: How
  46. Calculus

    An object is traveling along the x axis so that its speed is given by v(t)=t^2-7t+10 m/s. (a) Find the times when the object is at rest. (b) Find the acceleration at both of these times. Interpret the acceleration in terms of the motion of the object, ie
  47. college

    The proposed developer employed only certified programmers. Over the past five years they have redesigned more than 50 databases for local businesses. They will add innovative new functionalities to our system, while increasing the efficiency of our
  48. Accounting

    Can someone show me this bank reconciliation? On Aug 14th, One of our Partner's ( Compuville ) cash book showed a debit balance of $4,000.00. His bank statement showed a balance of $4,270.00. On comparison the following were found: * check issued amounting
  49. IT

    Use Microsoft® Project to develop a Work Breakdown Structure (WBS) for your project defined in Week 2. Include a 100- to 150-word description of how and why you would use a WBS in a project. · Post your completed WBS and my project is on upgrading a
  50. Finance

    You were hired as a consultant to Giambono Company, whose target capital structure is 40% debt, 15% preferred, and 45% common equity. The after-tax cost of debt is 6.00%, the cost of preferred is 7.50%, and the cost of retained earnings is 13.00%. The firm
  51. A&P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? 1A. What is its mRNA nucleotide sequence? AGCCCGAUGUUUUGUUUAGUUGCCCCGAGCGUUUGUUUAUUUGCC 1B. Indicate the product
  52. econ

    The economist for the Grand Corporation has estimated the company’s cost function, using the times series data to be TC=50+16Q-2Q2+0.2Q3 a. Plot this curve for quanties 1 to 10 b. Calculate the average total cost, average variable cost and marginal cost
  53. Discrete Structures

    Consider the divisibility relation on the set S = {-5,-3,-2,2,3,5} To be more precise, this is the relation: R = {(x, y) ∈ S^2| x divides y}. Is the relation Reflexive? Symmetric? Anti-symmetric? Transitive? ----------------------- The relation is
  54. history

    Homework Help: social studies Posted by anonymous on Tuesday, November 29, 2016 at 4:10pm. At home on the hills of Vermont or in the woods of Maine or the Texan ranch comrade of Californians comrade of free north sweeteners of every hue caste am I of every
  55. math

    I have 209.2 cups of cupcake batter in a bowl. If each cupcake uses 4 cups of batter, how many cupcakes can be made? How many times bigger do the divisor and dividend need to be in order to solve this problem? I divided 209.2 by 4 and got an answer of 52.3
  56. math (stats)

    Enter your answers as decimals or fractions, rather than percents. In a family with 7 children what is the probability of having 4 boys and then 3 girls, in that order? (Exclude multiple births and assume all outcomes are equally likely). Preview In a
  57. physics! description explanations

    The graph at the right is a positive vs. Time graph for the motion of an object moving along a horizontal (x) axis For each of the 8 1-second time intervals, describe the displacement, instantaneous velocity (+/- and whether the velocity is increasing or
  58. Check please science

    Cells are to tissues as organs are to 1 ORGAN SYSTEM 2 CELLS 3 GENES 4 ORGANELLES IS THE ANSWER 1 ORGAN SYSTEM Which of statements about cells is not true? 1. One or more cells make up all living organisms 2 cells carry on the basic life functions of
  59. Statistics

    The Tyco Video Game Corporation finds that it is losing income because of slugs used in its video games. The machines must be adjusted to accept coins only if they fall within set limits. In order to set hose limits, the mean weight of quarters in
  60. English

    I varied the sentences considering the students' point of view. Thank you very much for your advice They will be able to: 1)be familiar with the necessary linguistic structures to operate in a global study environment by taking a mainstream GE (General
  61. physics

    In the outer space, a constant force is applied to a 32.5 kg probe initially at rest. The probe moves a distance of 100 m in 10 s. (a) What acceleration does this force produce? (b) What is the magnitude of the force?
  62. college Algebra/Linear Algebra

    Find a Basis for each of these substances of R^4 (a) All vectors whose components are equal (b) All vectors whose component add to zero (c) All vectors that are perpendicular to (1,1,0,0) and (1,0,11) (d) The column space (In R^2) and nullspace(In R^5) of
  63. Math

    I don't know how to solve this math problem? A call center is 120 yd. long and 40 yd. wide. Each employee requires 30 sq. ft. if the center needs to have 40% of open space, how many employees can be seated in the center?
  64. math

    At soap and suds there are 16 washing machines in a single row with no space between each one.Each washing machine is 75cm across.Wht is the total length of the 16 washing machines in centimeters and meters???
  65. math

    at a mountain village in new guinea it rains on average 6 days a week. determine the probability that it rains on 1. any one day 2. two successive days 3. three sucessive days. what is the sample space/
  66. math

    at a mountain village in new guinea it rains on average 6 days a week. determine the probability that it rains on 1. any one day 2. two successive days 3. three sucessive days. what is the sample space/
  67. physics

    with earths mass 6 x 10^24 kg and radius6.38 x 10^6, how does the inverse-square law show that in space shuttle territory, 200 km above earths surface, the force of gravity is about 94% that at Earths surface
  68. chemistry class

    A flask is charged with 0.124 mol of A and allowed to react to form B according to the reaction A(g) → B(g). The following data are obtained for (A) as the reaction proceeds: Time (s) 1 10 20 30 40 Moles of A 0.124 0.110 0.088 0.073 0.054 1) The
  69. HR

    . Which of the following is not an advantage of a balanced scorecard? A. Communicating a balanced scorecard helps employees understand the organization's goals and how they might contribute to these goals. B. A balanced scorecard links external pay rates
  70. math

    Below is a function the represents the sales for tickets to battle of the Bands Phoenix Music Festival. Student council needs students to buy ticket early in order to book a venue. In order to do this they made a piece scale as follows, where x is the days
  71. math

    Below is a function the represents the sales for tickets to battle of the Bands Phoenix Music Festival. Student council needs students to buy ticket early in order to book a venue. In order to do this they made a piece scale as follows, where x is the days
  72. math

    Two points, A and B, are 275 ft apart. At a given instant, a balloon is released at B and rises vertically at a constant rate of 2.5 ft/sec, and, at the same instant, a cat starts running from A to B at a constant rate of 5 ft/sec. a) After 40 seconds, is
  73. chemistry

    Which of the following statements is NOT true in regards to water, ethanol, and isopropanol? A. H-O-H and C-O-H bond angles are all equal to 1095. B. Two lone pairs of electrons are assigned to the oxygen in each Lewis structure of all three molecules. C.
  74. english

    Can I please, please get some websites that will show me the local government structure of dekalb county (atlanta, georgia), and, political issues concerning dekalb county. This is stuff I need for my paper, I've been searching google all day, but nothing
  75. ENGLISH

    I've been given this question for the novel THE GREAT GATSBY and have been stuck on how to answer it for hours. "Boy meets girl...boy loses girl" this novel is merely another love story. to what extentdo you share this opinion of the novel? Im not sure how
  76. chemistry

    Which of the following statements is NOT true in regards to water, ethanol, and isopropanol? A. Water has the highest boiling point. B. Two lone pairs of electrons are assigned to the oxygen in each Lewis structure of all three molecules. C. Dispersion
  77. chemistry

    Which of the following statements is NOT true in regards to water, ethanol, and isopropanol? A. H-O-H and C-O-H bond angles are all equal to 109.5. B. Dispersion forces affect all three molecules. C. Two lone pairs of electrons are assigned to the oxygen
  78. chemistry

    Which of the following statements is NOT true in regards to water, ethanol, and isopropanol? A. Two lone pairs of electrons are assigned to the oxygen in each Lewis structure of all three molecules. B. Dispersion forces affect all three molecules. C. H-O-H
  79. Chemistry

    Which of the following statements is NOT true in regards to water, ethanol, and isopropanol? A. Two lone pairs of electrons are assigned to the oxygen in each Lewis structure of all three molecules. B. H-O-H and C-O-H bond angles are all equal to 1095. C.
  80. Science

    Why would people need to travel to the moon? what data do they collect on the moon? I am doing a space project, I choose the moon, but I don't know why I would travel there.....
  81. working with school-age children

    Which of the following is one of the steps for successful inclusion? 1) Use every inch of space in designated areas. 2)Organize all children in an assigned, designated area. 3) Modify appropriate environments and curriculum. 4)Provide every program
  82. Algebra

    Swimming space. The length of a rectangular swimming pool is 2x-1meters, and the width is x+12 meters. Write a polynomial A (x) that represents the area. Find A (5) Answer: Area=(2x-1) (x+12)sq m A=2x(x+12)-1(x+12) =2x^2+24x-x-12 =2x^2+23x-12 sq m X=5
  83. Physics

    Cosmic microwave background radiation fills all space with an average energy density of 4 x 10^-14 j/m^3.(a) Find the rms value of electric field associated with this radiation.(b) How far from a 7.5 kW radio transmitter emitting uniformly in all direction
  84. Electromagnetic spectrum

    Some astronomical objects emit no visible light but are known through (blank?) and radio images; satellite observations (blank?) Earth's atmosphere help scientists study space at wavelengths that do not reach Earth's surface?
  85. Physics :(( help please TT

    The space shuttle had a top orbital speed of 8000 m/s and orbited in a circular orbit approximately 320 km above the earth's surface. How long was one orbit in seconds? Details and assumptions The radius of the earth is 6370 km.
  86. Education

    The major emphasis of Movement programs for young children is the development of concepts. In what three major categories are they broken into? Body,space,time What , who, were Movement skill and fitness Awareness , knowledge and understanding I think it's
  87. math

    air fare club offers membership at $300.00, at least 50 people must join.For every member over 50 their fare will be reduced by $2 for every member. Due to space limits only 125 passengers will be allowed. how many memberships will maximize the revenue?
  88. Chem

    The space probe Pioneer 11 was launched April 5,1973, and reached Jupiter in December 1974 traveling a distance of 998 million km. How long did it take an electromagnectic signal to travel to earth from Pioneer 11 when it was near Jupiter.
  89. Physics

    In deep space, a small rock orbits an asteroid. The circular, orbit radius (between their center of masses) is 1037 m and the velocity of the rock is 8.02 m/s. Find the mass (kg) of the asteroid. G=6.67x10^-11 m^3/kgs^2. I got 1.0x10^15 but that is
  90. Math, physics

    A rotating space station has radius 1380 m, measured from the center of rotation to the outer deck where the crew lives. What should the period of rotation be if the crew is to feel that they weigh one-half their Earth weight?
  91. Language/Listening Skills

    Would (D) be the best answer for this question? Listening activities should be: A. on the floor,in a corner of the room. B. in a large area for children to have space and feel comfortable. C. required of all students D. in a small area with the least
  92. painting

    compare and contrast the representation of weight and space in the painting of The Good Shepherd in the Catacomb of Saints Pietro and Marcellino (Image 15-2) and the mosaic of Justinian and Attendants in Ravenna's Church of San Vitale (Image 15-5)
  93. Physics

    It has been suggested that cylinders rotating about their long axis with dimensions 19 km long and 6.9 km in diameter be placed in space and used as colonies. What angular speed must such a cylinder have so that the centripetal acceleration at its surface
  94. physics

    You are explaining to friends why astronauts feel weightless orbiting in the space shuttle, and they respond that they thought gravity was just a lot weaker up there. Convince them and yourself that it isn't so by calculating how much weaker gravity is at
  95. physics

    You are explaining to friends why astronauts feel weightless orbiting in the space shuttle, and they respond that they thought gravity was just a lot weaker up there. Convince them and yourself that it isn't so by calculating how much weaker gravity is at
  96. Math

    Alex made a sketch for a homemade soccer goal he plans to build. The goal will be in the shape of a triangular prism. The legs of the right triangles at the sides of his goal measure 4 ft and 8 ft, and the opening along the front is 24 ft. How much space
  97. physics Classical Mechanics

    Consider a rocket in space that ejects burned fuel at a speed of vex= 1.5 km/s with respect to the rocket. The rocket burns 8 % of its mass in 280 s (assume the burn rate is constant). (a) What is the speed v of the rocket after a burn time of 140.0 s?
  98. Calculus

    In a right triangle, the hypotenuse is of fixed length of 15 units, one side is increasing in length by 4 units per second while the third side is decreasing in size. At a certain instant the increasing side is of length 9 units. Find the rate of change of
  99. english

    4. Which of the following sentences contains a comma splice? A.The kitten climbed the drapes, it couldn't figure out how to get down. B.The cruise ship docked on Oahu, then again on Maui. C.We need help with organization, structure, and spelling. D.Our
  100. history

    can someone pleeease give me some helpful information, or some good points, with which i could answer this question. it will be veryyyy much appreciated. thank you compare the colonial empires of Spain, France and England in terms of their settlements,