1. algebra

    order of operations 10) 2^4-3^2+5^2 11)32/(-7+5)^3 12)4^3-(2-5)^3

    asked by cindy on August 10, 2013
  2. Math

    What is the order for 2/5, 9/10, 1/3, .50, .05 from least to greatest?

    asked by Anonymous on June 29, 2015
  3. math

    order of operations 10) 2^4-3^2+5^2 11)32/(-7+5)^3 12)4^3-(2-5)^3

    asked by kyle on August 10, 2013
  4. Algebra

    Which are the order pair for 3x+y>6

    asked by Brock on November 3, 2016
  5. math

    Order from least to greatest 7/12,0.75,5/6

    asked by Lupe on September 2, 2015
  6. Algebra

    Order 3.21 x 10, 42 x 10^4, and 0.11 x 10^10 from least to greatest

    asked by Mae on May 25, 2015
  7. math

    I need the order from least to greatest 4/9 5/6 1/2 2/3

    asked by talia on October 4, 2015
  8. math

    can you please help me order 0.8,7/8,81%,and 19/25 from least to greatest?

    asked by Shannon on January 9, 2018
  9. Math

    What are 3/8, 5/6, and 1/2 in order from least to greatest.

    asked by Rachel on November 20, 2012
  10. maths

    all the angles in order

    asked by katelyn on March 23, 2011
  11. math

    Need these in order from least to greatest 1/2 5/6 1/4

    asked by minco elementary on March 31, 2016
  12. Math

    Order from least to greatest. -4, -3.9, - 2/9, 2/11

    asked by Jane on October 22, 2013
  13. algebra

    x^3+4a+5a^2x^6 ascending order

    asked by will on February 9, 2014
  14. Math

    What is 4,-6,0,8,-9 in ascending order

    asked by Uggg on September 15, 2016
  15. algebra

    order these from least to greatest 0.67, 9/10,0,-0.11

    asked by luna on January 3, 2018
  16. math

    order from least to greatest 0.29, 2/7, 25%, 0.2

    asked by Anonymous on January 10, 2018
  17. math

    how do I order these from least to greatest: 1/2, -0.75, 0.6, -1/2

    asked by sarah on September 27, 2016
  18. math algebra?

    Is 1/3 , 3/4 , 0.2 in order from least to greatest or is 5 1/8 , 5 1/4 , 5 2/3 in order from least to greatest?

    asked by anon on June 3, 2014
  19. Math

    What is the order of the set a={-1,20,3,17,5}

    asked by Tony on April 22, 2014
  20. MATH(order of operations help)

    Why do we need the order of operations? What is the order of operations?

    asked by dry on September 9, 2011
  21. math

    order from least to greater 4 1 over 2, 19 over 4, 37 over 8, 4 3 over 16

    asked by naomi on September 22, 2014
  22. math115

    ascending order= -2/9, -1/9, 3/7, 5/9, 1/8?

    asked by p on October 15, 2009
  23. math

    order 3/10 from least to greastest

    asked by mara on September 3, 2012
  24. 7th grade math

    order of operations 11, 10, 15, 20, 3 = 6

    asked by will on September 22, 2010
  25. Algebra

    What is the order of 5 X 10^-8, 7 X 10^-9, 3 X 10^-9, 8 X 10^4 from least to greatest? Is it 3 X 10^-9, 7 X 10^-9, 5 X 10^-8, 8 X 10^4?

    asked by Anonymous on February 6, 2014
  26. math

    What is 2/3 , 3/4 , 7/12 on descending order

    asked by shanice henry on September 29, 2016
  27. I need to make sure this is right!

    Order from least to greatest. 0.29, 2/7, 25%, 0.2 25%, 0.2, 2/7, 0.29 0.2, 25%, 2/7, 0.29 *** 0.29, 2/7, 25%, 0.2 0.29, 2/7, 0.2, 25%

    asked by DJ on January 2, 2018
  28. math

    -1/3, 2/3, -5/6, -0.3 order from least to greatest

    asked by lilly on November 8, 2010
  29. Math

    Order the following from least to greatest 0.3 3/5 0.66 2/3 0.35

    asked by Jacob on February 1, 2017
  30. Math

    0.85,0.89,0.9,0.8 order from least to greater

    asked by Saima on April 30, 2016
  31. math

    4x-10=y order pairs

    asked by Maya on April 22, 2009
  32. math

    What is the order of 1.1 × 10, 1.2 × 10−, 1.7 × 10−, and 1 × 10 from least to greatest?

    asked by coolcat on February 9, 2017
  33. math

    can you order 2/3 3/4 5/6 from least to greatest

    asked by james on January 4, 2013
  34. Algebra

    -3+5(-6)-[8-6*7)-4(13-5)]-3(-8-10) Order Of operation

    asked by Anonymous on January 14, 2011
  35. math

    What is the order of 1.5 x 10^3, 1.4 x 10^-1, 2 x 10^3, and 1.4 x 1-^-2 from least to greatest?

    asked by Daniel on November 15, 2010
  36. math

    order from least to greatest 41.2 41.42 40.12

    asked by ciara on February 23, 2012
  37. math

    compare and order 7/12, 2/3, and 6/15

    asked by Cullen on November 14, 2012
  38. Python: Named tuples

    I've been trying to print a list of the book titles within the named tuple in alphabetical order, but I don't know what I'm doing wrong. I've set up my named tuple as so: Book = namedtuple('Book', 'author title genre year price instock') # Book attributes:

    asked by Student on January 24, 2014
  39. Accounting

    Need help with this bank reconciliation...this is actually for a job and I am forgetting everything about accounting because I am nervous. BANK RECONCILATION ============================================== On Aug 14th, One of our Partner's ( Compuville )

    asked by Tiffany on November 17, 2010
  40. Anatomy and Physiology

    Which one of the following groups of structures is involved in regulating calcium levels? A. Parathyroid, thymus, intestines, kidneys, and bones. B. Parathyroid, bones, intestines, kidnesy, and adrenal glands. C. Thyroid, parathyroid, bones, intestines,

    asked by Kay on February 22, 2009
  41. English

    I have a doubt concerning the following structure: The Asiatic lions are in danger of extinction, as are the Asiatic cheetahs. (like the Asiatic cheetahs is also possible?) Where is this rule explained: as + verb + word like + word

    asked by Henry2 on November 7, 2011
  42. English

    I revised the sentences again. Now I really need your final check At the end of their two-year project students will be able to 1) master the basic linguistic structures to operate in a work/scientific environment (I don't know how to express it) 2) be

    asked by Henry2 on February 1, 2012
  43. Science help

    Will someone please check my work for me? Molecules involved in a chemical reaction must meet to react. What is this concept called? entropy enthalpy collision theory

    asked by Napolian 2 on June 21, 2012
  44. physics! description explanations

    The graph at the right is a positive vs. Time graph for the motion of an object moving along a horizontal (x) axis For each of the 8 1-second time intervals, describe the displacement, instantaneous velocity (+/- and whether the velocity is increasing or

    asked by Lina on January 7, 2016
  45. physics

    A space traveler weighs 635 N on earth. What will the traveler weigh on another planet whose radius is three times that of earth and whose mass is twice that of earth?

    asked by Donald on October 4, 2012
  46. Statistics

    The mean length of the first 20 space shuttle flights was about 7 days with a standard deviation of about 2 days. Using Chebychev's theorem, at least how many of the flights lasted between 3 and 11 days.

    asked by Kenneth on November 16, 2013
  47. physics

    A space traveler weighs 620 N on earth. What will the traveler weigh on another planet whose radius is three times that of earth and whose mass is twice that of earth?

    asked by Anonymous on January 31, 2012
  48. science

    2) Which is not an example of matter? A. water B. air(i think it this one) C. gold D. sound 3) The amount of space an object occupies is called its ..... A. volume(i think it this one) B. mass C. electricity D. gravity 4) Atoms in a molecule are joined

    asked by eduarda on December 12, 2014
  49. Math

    I need to research the following fractal-related topics and find enough information to write five sentences. a. a Peano curve b. the devil's staircase c. self-similarity d. space-filling curve I also need to find out how the concept of fractals is applied

    asked by Anna on April 8, 2009
  50. Physics

    (A) Identify how the gravitational potential energy changes as a shuttle takes off from the launch pad. (b) Explain the consequences to the space craft and its occupants if the shuttle is undergoing re-entry, and the angle of re-entry is significantly

    asked by Alfred on August 31, 2009
  51. Physics

    Which of the following exhibits parabolic motion? a. a stone thrown into a lake b. a space shuttle orbiting Earth c. a leaf falling from a tree d. a train moving along a flat track what is parabolic motion? which would be a good choice? thanks alot for ur

    asked by y912f on February 5, 2009
  52. Physics

    A cricket ball rotates at 1800 rev/min as it travels through the space in a straight line at 160 km/hr. How many times does it revolve after traveling 20m? Can someone confirm with me if 13.5 revolutions in 20m is right. That's the answer i got too. If

    asked by Yoyo on August 7, 2015
  53. Chemistry

    The space probe Pioneer 11 was launched April 5,1973, and reached Jupiter in December 1974 traveling a distance of 998 million km. How long did it take an electromagnectic signal to travel to earth from Pioneer 11 when it was near Jupiter. Where do I

    asked by Lauren on November 2, 2007
  54. College algebra!

    For the linear function f(x) = 5x + 3 (a) Determine the slope and y-intercept (b) Use the slope and y-intercept to graph the linear function. (c) Determine the average rate of change of the function (d) Determine whether the linear function is increasing,

    asked by Jenn on March 15, 2013
  55. science

    When salt (NaCI) is added to water, it disassociates into Na and Cl-ions. Which of the following types of chemical bond is present in a salt molecule? A. Covalent bond B. Ionic bond C. Hydrogen bond D. Disulfide bond i think its B An example of active

    asked by manny on October 25, 2015
  56. science

    How are moon observations from space different from moon observations made on Earth? I think there is no deifference.

    asked by Nour on July 30, 2015
  57. math-urgent

    Sample space ={1,2,3,4,5} p(1)=0.1, p(2)=0.2 and p(3)=p(4)=0.05. Assume that A={1,3,5} and B={2,3,4}. Find p(5). Find p(A^c). I need help with this question. It is a probability question. please help.

    asked by Temmick on April 7, 2014
  58. help math

    a partial moves along the x-axis so that its velocity at time t, for 0< = t = < 6, is given by a differentiable function v whose graph is shown above. The velocity is 0 at t=0, t=5, and the graph has horizontal tangents at t=4. the areas of the regions

    asked by dave on May 21, 2008
  59. Calc

    a partial moves along the x-axis so that its velocity at time t, for 0< = t = < 6, is given by a differentiable function v whose graph is shown above. The velocity is 0 at t=0, t=5, and the graph has horizontal tangents at t=4. the areas of the regions

    asked by sammy on May 20, 2008
  60. Calc

    "Let f(x,y)=2(x^2)y-(y^3)+x-4. a) Find the local linearization of f at (3,1) b) Compute the directional derivative of f at (3,1) in the direction towards the point (-2,3). At (3,1), is the function f increasing or decreasing in the direction towards the

    asked by Brittany on March 1, 2011
  61. Statistics

    The Tyco Video Game Corporation finds that it is losing income because of slugs used in its video games. The machines must be adjusted to accept coins only if they fall within set limits. In order to set hose limits, the mean weight of quarters in

    asked by Lizzy on July 22, 2015
  62. finance

    You were hired as a consultant to Giambono Company, whose target capital structure is 40% debt, 15% preferred, and 45% common equity. The after-tax cost of debt is 6.00%, the cost of preferred is 7.50%, and the cost of retained earnings is 12.75%. The firm

    asked by adam on April 2, 2011
  63. A&P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? 1A. What is its mRNA nucleotide sequence? AGCCCGAUGUUUUGUUUAGUUGCCCCGAGCGUUUGUUUAUUUGCC 1B. Indicate the product

    asked by ISSY on June 8, 2013
  64. chemistry

    I have to draw the QMM of CL2C2. For the Lewis structure i think that the two C ayoms form a triple bond and the Cl atoms form single bonds. Therefore i think that the central C atom hybridizes into sp. if this is correct, my question is how do i know

    asked by lyne on April 30, 2009
  65. IT

    Use Microsoft® Project to develop a Work Breakdown Structure (WBS) for your project defined in Week 2. Include a 100- to 150-word description of how and why you would use a WBS in a project. · Post your completed WBS and my project is on upgrading a

    asked by Becky on May 27, 2009
  66. Accounting

    Can someone show me this bank reconciliation? On Aug 14th, One of our Partner's ( Compuville ) cash book showed a debit balance of $4,000.00. His bank statement showed a balance of $4,270.00. On comparison the following were found: * check issued amounting

    asked by Lee on January 19, 2013
  67. Maths

    A hollow cube of internal edge is 22cm is filled with spherical marbles of diameter 0.5cm and it is assumed that 1/8 space of the cube remain unfilled.Then the number of marbles that the cube can accomodate is?

    asked by Princ on February 8, 2016
  68. RE

    i have to write a poem about 'your expression of the vastness of space/universe as a poem. i have all the ideas in my head about the universe being incredibly vast. but im rubbish at writing poems. Can anyone help or find a useful website that has a poem

    asked by Nabiha on February 10, 2009
  69. college

    The proposed developer employed only certified programmers. Over the past five years they have redesigned more than 50 databases for local businesses. They will add innovative new functionalities to our system, while increasing the efficiency of our

    asked by Anonymous on January 29, 2016
  70. Calc

    analaze the graph of y = 2/ (x^2-9) y-intercepts: ____________________ vertical asymptotes: ____________________ horizontal asymptotes: ____________________ increasing intervals: ____________________ decreasing intervals: ____________________ relative

    asked by Jordan on January 24, 2012
  71. Language Arts ~CHECK MY WORK PLEASE~

    1. What can you predict about the poem by previewing the title, subtitle, and first line of the poem "In response to executive order 9066"? a.) It will be a letter to the Japanese-American citizens in which they are told they must leave their homes. b) It

    asked by Jenny on February 5, 2014
  72. math

    Scott, Mike, and Holly shared an order of French fries. Scott ate x fries. Mike ate one more than twice the amount of fries that Scott ate. Holly ate 5 fewer fries than Scott did. If there were 6 fries left, how many fries were in the order? a. x-5 b. x c.

    asked by Tomas on November 14, 2013
  73. HR

    . Which of the following is not an advantage of a balanced scorecard? A. Communicating a balanced scorecard helps employees understand the organization's goals and how they might contribute to these goals. B. A balanced scorecard links external pay rates

    asked by blue on August 3, 2018
  74. home economics

    The economist for the Grand Corporation has estimated the company’s cost function, using the times series data to be TC=50+16Q-2Q2+0.2Q3 a. Plot this curve for quanties 1 to 10 b. Calculate the average total cost, average variable cost and marginal cost

    asked by Anonymous on February 24, 2008
  75. econ

    The economist for the Grand Corporation has estimated the company’s cost function, using the times series data to be TC=50+16Q-2Q2+0.2Q3 a. Plot this curve for quanties 1 to 10 b. Calculate the average total cost, average variable cost and marginal cost

    asked by Anonymous on February 24, 2008
  76. accounting 220

    Final Project: Final Project • Resources: Appendix A • Due Date: Day 7 [post in the Individual forum] • Write a 700-1,050 word paper, using APA guidelines, based on following scenario. You want to start your own business. You found an investment

    asked by Amber on February 4, 2010
  77. math

    Below is a function the represents the sales for tickets to battle of the Bands Phoenix Music Festival. Student council needs students to buy ticket early in order to book a venue. In order to do this they made a piece scale as follows, where x is the days

    asked by dai on March 9, 2016
  78. math

    Below is a function the represents the sales for tickets to battle of the Bands Phoenix Music Festival. Student council needs students to buy ticket early in order to book a venue. In order to do this they made a piece scale as follows, where x is the days

    asked by Dai help help! on March 10, 2016
  79. Management & Economics

    a producer of light bulbs claims to have the folllowing production function: Q=10L*G. a) what is the marginal product of labor? or glass? b)Draw the relavant isoquant map and isocost line if the cost of labor is $4 per work-hour and the cost of glass is $4

    asked by Lisel on September 17, 2011
  80. science

    Which of the following would increase the effect of tides on Earth (high tides get higher, low tides get lower) - slowing the rate of rotation of the Moon. - increasing the rate of rotation of the Moon. *** - decreasing the distance between the Earth

    asked by ally on September 23, 2017
  81. science

    Which of the following would increase the effect of tides on Earth (high tides get higher, low tides get lower) - slowing the rate of rotation of the Moon. - increasing the rate of rotation of the Moon. *** - decreasing the distance between the Earth

    asked by ally on September 23, 2017
  82. Biology

    In detail can someone please explain to me how cooking eggs makes them safe to eat in connection with enzymes Thank you I understand that enzymes are killed because of the heat as it is a factor in destroying the enzymes activity but how does this explain

    asked by carly on October 25, 2010
  83. Us history please help

    The] said Cooper Hughs Freedman with his wife...are to work on said farm and to cultivate forty acres in corn and twenty acres in cotton, to assist in putting the fences on said farm in good order and to keep them so and to do all other work on said farm

    asked by Anonymous on April 9, 2018
  84. Geometry

    Jason designed an arch made of wrought iron for the top of a mall entrance. The 11 segments between the two concentric circles are each 1.25 m long. Find the total length of wrought iron used to make the structure. Round the answer to the nearest meter.

    asked by Brittany on November 20, 2013
  85. Analytical Chemistry

    Show the predominant form of the amino acid tyrosine at pH=13.9 and ph=7.8. Be sure to include the proper number of hydrogens on heteroatoms and the correct formal charges on atoms. I calculated the pka values for COOH (pka=2.41) NH3 (pka=8.67), and OH

    asked by Sam on February 27, 2013
  86. Social studies

    In which way are the governments of Saudi Arabia and Oman most similar? Their rulers are related. They both have absolute monarchies. They have newly written constitutions. Their structures descend from Ottoman caliphs. 14. What do young Israelis and young

    asked by Anonymous on March 12, 2015
  87. History

    In four, explain how the structure of the First Amendment supports equal weight of each freedom it guarantees. "Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof; or abridging the freedom of

    asked by Ari on January 8, 2018
  88. math algebra

    The sum of 2 numbers is 400.If the first number is decreased by 20% and the second number is decreased by 15% then the sum would be 68 less than 400.Find the numbers after the decreasing.

    asked by someone please help!!! on May 27, 2017
  89. Biology

    MEIOSIS 1)name the process unique to meiosis that occurs during bivalent formation that may increase genetic diversity? 2)how are sister chromatic made and what is the structure that holds them together? 3)what do we call package of genetic information

    asked by sk on February 22, 2016
  90. Chemistry (equilibrium)

    C2H6(g) C2H2(g) + 2 H2(g) The ΔH° for the reaction above is +312 kJ. The system is initially at equilibrium. In which direction will the reaction shift in each of the following situations? e) The temperature is decreased. g) He is added at constant

    asked by Paige on September 10, 2016
  91. Calculus

    An object is traveling along the x axis so that its speed is given by v(t)=t^2-7t+10 m/s. (a) Find the times when the object is at rest. (b) Find the acceleration at both of these times. Interpret the acceleration in terms of the motion of the object, ie

    asked by Mike on May 15, 2013
  92. chemisrty

    Rank following acids frommost to least acidic: hydrocyanic acid (HCN) Ka = 6.2 × 10−10 hypoiodous acid (HOI) Ka = 2 × 10−11 chlorous acid (HClO2) Ka = 1.2 × 10−2 acetic acid (CH3COOH) Ka = 1.8 × 10−5 1. HOI > HClO2 > CH3COOH > HCN 2. CH3COOH >

    asked by susan on June 8, 2014
  93. UNDERSTANDING OBSERVATION AND BEHAVIOR

    The Child Development Checklist is an observation tool that A. includes space to record non-objective data. B. omits references to children's emotions. C. focuses on sequences of child development. D. can only be used by one observer for the same child.

    asked by Anonymous on April 5, 2013
  94. mechanics

    A space aircraft is launched staight up.The aircraft motor provide aconstant acceleration for 10 second ,then it stops.the aircraft's altitude 15 second after launch is 2 km.ignore air friction.what is the acceleration and the maximum speed reached in

    asked by shone on April 4, 2013
  95. Physics (Electric fields and Coulomb's Law)

    I need help with this question please. An ion harvester is scouring deep space for isolated xenon (Xe+) ions. A xenon ion is singly ionized, and has a charge of +e. If the field meter reads 0.000000202 N/C, how far away is it from the ion? _________ m

    asked by Kathy on April 22, 2013
  96. ECE

    the child development checklist is an observation tool that? A.can only be used by one observer for the same child B.omits references to childrens emotions. C.includes space to record non-objective data. D.focuses on sequences of child development

    asked by Leeann on December 7, 2012
  97. PRE-CALC

    A number is selected at random from the set {2, 3, 4, … ,10}. Which event, by definition, covers the entire sample space of this experiment? A) The number is greater than 2. B) The number is not divisible by 5. C) The number is even or less than 12. D)

    asked by Shawna on March 18, 2014
  98. english

    I need to know how to find the plot in a poem. The poem is "The Passionate Shepherd to His Love" by Christopher Marlowe http://en.wikipedia.org/wiki/Plot_%28narrative%29 Scroll down to the list in Typical plot structure and see how the events in this poem

    asked by april on April 13, 2007
  99. anthropology

    what is the family structure of chinese families and Indian families. Thank you for using the Jiskha Homework Help Forum. Try these sites: 1. http://www.nira.go.jp/publ/houko/i980116.html 2. http://en.wikipedia.org/wiki/Chinese_culture 3.

    asked by singh on August 10, 2007
  100. Anatomy

    Can someone help me answer these 4 questions I have? Skeletal muscle cell are long and do not branch. Why is this the best structure for this type of muscle? Why does having many long, branched dendrites and axons beneficial for nervous tissue? How does

    asked by John on January 22, 2009