1. geography check

    the atmosphere:A)creayes tides b)has no effect on heat gain or loss c)allows heat to escape quickly D)keeps heat from escaping too quickly into space. i choose b
  2. math

    At Soap ans Suds there are 16 washing machines in a single row with no space between each one.Each washing mashine is 2 feet 5 inches across. What is the total length of the 16 washing machines?
  3. math

    A cue shaped box fits exactly around a soccerball with a diameter of 22.28 cm. What percent of the box is empty space? Help understand how to get to the answer, and wat it would be Cube shaped box*
  4. physics

    A 1000kg rocket is moving forward at 10m/s in space. A 10,000N force is applied to the rocket for one second from behind. How fast is the rocket now traveling? a. 0m/s b. 10m/s c. 15m/s d. 20m/s
  5. Math

    A rectangular family room has 204 square feet of floor space. If its length is 17 feet, how many feet wide is it? A. 18 B. 12 C. 17 D. 187 E. Not enough information is given. Answer: 204/17=12
  6. Math

    It is recommended that there be at least 7 square feet of work space for every person in a conference room. A certain conference room is 13' by 16'. Find the maximum number of people the room can accommodate.
  7. science

    What are the consequences of avoiding stress management? Consider all six dimensions of wellness. Here are some results I have come up with? Is there more? Science and medical studies have substantiated that we can avoid the detrimental outcomes of
  8. chemistry

    N2(g) + 3 F2(g) → 2 NF3(g) ΔH° = –264 kJ/mol ΔS° = –278 J/(mol∙K) a. calculate the maximum amount of non-PΔV work that can be accomplished through this reaction at a temperature of 500°C. b. Determine the temperature at
  9. Statistics

    The mean length of the first 20 space shuttle flights was about 7 days with a standard deviation of about 2 days. Using Chebychev's theorem, at least how many of the flights lasted between 3 and 11 days.
  10. physics

    A space traveler weighs 620 N on earth. What will the traveler weigh on another planet whose radius is three times that of earth and whose mass is twice that of earth?
  11. Finite Math

    Let A and B be two events in a sample space S such that P(A) = 0.5, P(B) = 0.6, and P(A intersection B) = 0.15. Find the probabilities below. Hint: (A intersection Bc) union (A intersection B) = A. (a) P(A|Bc) ________ (b) P(B|Ac) ________
  12. Linear Algebra

    4 points A,B,C and D are situated in a 3-dimensional space. In a certain spot, the coordinates of A, C and D are known: A(1,1,1) C(2,0,1) D(0,3,0) The coordinates of the barycentre of {A,B,C} are: (4/3, 1/3, 4/3). a) Determine the coordinates of point B in
  13. Linear Algebra

    4 points A,B,C and D are situated in a 3-dimensional space. In a certain spot, the coordinates of A, C and D are known: A(1,1,1) C(2,0,1) D(0,3,0) The coordinates of the barycentre of {A,B,C} are: (4/3, 1/3, 4/3). a) Determine the coordinates of point B in
  14. physics

    A space traveler weighs 635 N on earth. What will the traveler weigh on another planet whose radius is three times that of earth and whose mass is twice that of earth?
  15. algebra (inequalities)

    a weaver spends $420 on supplies to make wall hangings and plans to sell the wall hangings for $80 each. a. write an inequality that gives the possible numbers of (w) wall hangings the weaver needs to sell in order for the profit to be positive b. what are
  16. college

    The proposed developer employed only certified programmers. Over the past five years they have redesigned more than 50 databases for local businesses. They will add innovative new functionalities to our system, while increasing the efficiency of our
  17. Waves (8th Grade)

    Predict: How resonance can cause earthquakes to do greater damage to some buildings than others. Analyze: If two astronauts were able to go on a space walk without wearing suits. Explain why they would not be able to talk to one another. Describe: How
  18. Accounting

    Can someone show me this bank reconciliation? On Aug 14th, One of our Partner's ( Compuville ) cash book showed a debit balance of $4,000.00. His bank statement showed a balance of $4,270.00. On comparison the following were found: * check issued amounting
  19. Calculus

    An object is traveling along the x axis so that its speed is given by v(t)=t^2-7t+10 m/s. (a) Find the times when the object is at rest. (b) Find the acceleration at both of these times. Interpret the acceleration in terms of the motion of the object, ie
  20. Discrete Structures

    Consider the divisibility relation on the set S = {-5,-3,-2,2,3,5} To be more precise, this is the relation: R = {(x, y) ∈ S^2| x divides y}. Is the relation Reflexive? Symmetric? Anti-symmetric? Transitive? ----------------------- The relation is
  21. IT

    Use Microsoft® Project to develop a Work Breakdown Structure (WBS) for your project defined in Week 2. Include a 100- to 150-word description of how and why you would use a WBS in a project. · Post your completed WBS and my project is on upgrading a
  22. A&P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? 1A. What is its mRNA nucleotide sequence? AGCCCGAUGUUUUGUUUAGUUGCCCCGAGCGUUUGUUUAUUUGCC 1B. Indicate the product
  23. Finance

    You were hired as a consultant to Giambono Company, whose target capital structure is 40% debt, 15% preferred, and 45% common equity. The after-tax cost of debt is 6.00%, the cost of preferred is 7.50%, and the cost of retained earnings is 13.00%. The firm
  24. econ

    The economist for the Grand Corporation has estimated the company’s cost function, using the times series data to be TC=50+16Q-2Q2+0.2Q3 a. Plot this curve for quanties 1 to 10 b. Calculate the average total cost, average variable cost and marginal cost
  25. math

    I have 209.2 cups of cupcake batter in a bowl. If each cupcake uses 4 cups of batter, how many cupcakes can be made? How many times bigger do the divisor and dividend need to be in order to solve this problem? I divided 209.2 by 4 and got an answer of 52.3
  26. math (stats)

    Enter your answers as decimals or fractions, rather than percents. In a family with 7 children what is the probability of having 4 boys and then 3 girls, in that order? (Exclude multiple births and assume all outcomes are equally likely). Preview In a
  27. Check please science

    Cells are to tissues as organs are to 1 ORGAN SYSTEM 2 CELLS 3 GENES 4 ORGANELLES IS THE ANSWER 1 ORGAN SYSTEM Which of statements about cells is not true? 1. One or more cells make up all living organisms 2 cells carry on the basic life functions of
  28. physics! description explanations

    The graph at the right is a positive vs. Time graph for the motion of an object moving along a horizontal (x) axis For each of the 8 1-second time intervals, describe the displacement, instantaneous velocity (+/- and whether the velocity is increasing or
  29. English

    I varied the sentences considering the students' point of view. Thank you very much for your advice They will be able to: 1)be familiar with the necessary linguistic structures to operate in a global study environment by taking a mainstream GE (General
  30. Statistics

    The Tyco Video Game Corporation finds that it is losing income because of slugs used in its video games. The machines must be adjusted to accept coins only if they fall within set limits. In order to set hose limits, the mean weight of quarters in
  31. history

    Homework Help: social studies Posted by anonymous on Tuesday, November 29, 2016 at 4:10pm. At home on the hills of Vermont or in the woods of Maine or the Texan ranch comrade of Californians comrade of free north sweeteners of every hue caste am I of every
  32. college Algebra/Linear Algebra

    Find a Basis for each of these substances of R^4 (a) All vectors whose components are equal (b) All vectors whose component add to zero (c) All vectors that are perpendicular to (1,1,0,0) and (1,0,11) (d) The column space (In R^2) and nullspace(In R^5) of
  33. Math

    I don't know how to solve this math problem? A call center is 120 yd. long and 40 yd. wide. Each employee requires 30 sq. ft. if the center needs to have 40% of open space, how many employees can be seated in the center?
  34. physics

    In the outer space, a constant force is applied to a 32.5 kg probe initially at rest. The probe moves a distance of 100 m in 10 s. (a) What acceleration does this force produce? (b) What is the magnitude of the force?
  35. math

    at a mountain village in new guinea it rains on average 6 days a week. determine the probability that it rains on 1. any one day 2. two successive days 3. three sucessive days. what is the sample space/
  36. physics

    with earths mass 6 x 10^24 kg and radius6.38 x 10^6, how does the inverse-square law show that in space shuttle territory, 200 km above earths surface, the force of gravity is about 94% that at Earths surface
  37. math

    At soap and suds there are 16 washing machines in a single row with no space between each one.Each washing machine is 75cm across.Wht is the total length of the 16 washing machines in centimeters and meters???
  38. math

    at a mountain village in new guinea it rains on average 6 days a week. determine the probability that it rains on 1. any one day 2. two successive days 3. three sucessive days. what is the sample space/
  39. HR

    . Which of the following is not an advantage of a balanced scorecard? A. Communicating a balanced scorecard helps employees understand the organization's goals and how they might contribute to these goals. B. A balanced scorecard links external pay rates
  40. chemistry class

    A flask is charged with 0.124 mol of A and allowed to react to form B according to the reaction A(g) → B(g). The following data are obtained for (A) as the reaction proceeds: Time (s) 1 10 20 30 40 Moles of A 0.124 0.110 0.088 0.073 0.054 1) The
  41. math

    Below is a function the represents the sales for tickets to battle of the Bands Phoenix Music Festival. Student council needs students to buy ticket early in order to book a venue. In order to do this they made a piece scale as follows, where x is the days
  42. math

    Below is a function the represents the sales for tickets to battle of the Bands Phoenix Music Festival. Student council needs students to buy ticket early in order to book a venue. In order to do this they made a piece scale as follows, where x is the days
  43. math

    Two points, A and B, are 275 ft apart. At a given instant, a balloon is released at B and rises vertically at a constant rate of 2.5 ft/sec, and, at the same instant, a cat starts running from A to B at a constant rate of 5 ft/sec. a) After 40 seconds, is
  44. english

    Can I please, please get some websites that will show me the local government structure of dekalb county (atlanta, georgia), and, political issues concerning dekalb county. This is stuff I need for my paper, I've been searching google all day, but nothing
  45. chemistry

    Which of the following statements is NOT true in regards to water, ethanol, and isopropanol? A. Water has the highest boiling point. B. Two lone pairs of electrons are assigned to the oxygen in each Lewis structure of all three molecules. C. Dispersion
  46. ENGLISH

    I've been given this question for the novel THE GREAT GATSBY and have been stuck on how to answer it for hours. "Boy meets girl...boy loses girl" this novel is merely another love story. to what extentdo you share this opinion of the novel? Im not sure how
  47. chemistry

    Which of the following statements is NOT true in regards to water, ethanol, and isopropanol? A. H-O-H and C-O-H bond angles are all equal to 109.5. B. Dispersion forces affect all three molecules. C. Two lone pairs of electrons are assigned to the oxygen
  48. Chemistry

    Which of the following statements is NOT true in regards to water, ethanol, and isopropanol? A. Two lone pairs of electrons are assigned to the oxygen in each Lewis structure of all three molecules. B. H-O-H and C-O-H bond angles are all equal to 1095. C.
  49. chemistry

    Which of the following statements is NOT true in regards to water, ethanol, and isopropanol? A. Two lone pairs of electrons are assigned to the oxygen in each Lewis structure of all three molecules. B. Dispersion forces affect all three molecules. C. H-O-H
  50. chemistry

    Which of the following statements is NOT true in regards to water, ethanol, and isopropanol? A. H-O-H and C-O-H bond angles are all equal to 1095. B. Two lone pairs of electrons are assigned to the oxygen in each Lewis structure of all three molecules. C.
  51. Science

    Why would people need to travel to the moon? what data do they collect on the moon? I am doing a space project, I choose the moon, but I don't know why I would travel there.....
  52. physics

    You are explaining to friends why astronauts feel weightless orbiting in the space shuttle, and they respond that they thought gravity was just a lot weaker up there. Convince them and yourself that it isn't so by calculating how much weaker gravity is at
  53. Language/Listening Skills

    Would (D) be the best answer for this question? Listening activities should be: A. on the floor,in a corner of the room. B. in a large area for children to have space and feel comfortable. C. required of all students D. in a small area with the least
  54. painting

    compare and contrast the representation of weight and space in the painting of The Good Shepherd in the Catacomb of Saints Pietro and Marcellino (Image 15-2) and the mosaic of Justinian and Attendants in Ravenna's Church of San Vitale (Image 15-5)
  55. Physics :(( help please TT

    The space shuttle had a top orbital speed of 8000 m/s and orbited in a circular orbit approximately 320 km above the earth's surface. How long was one orbit in seconds? Details and assumptions The radius of the earth is 6370 km.
  56. Algebra

    Swimming space. The length of a rectangular swimming pool is 2x-1meters, and the width is x+12 meters. Write a polynomial A (x) that represents the area. Find A (5) Answer: Area=(2x-1) (x+12)sq m A=2x(x+12)-1(x+12) =2x^2+24x-x-12 =2x^2+23x-12 sq m X=5
  57. physics

    You are explaining to friends why astronauts feel weightless orbiting in the space shuttle, and they respond that they thought gravity was just a lot weaker up there. Convince them and yourself that it isn't so by calculating how much weaker gravity is at
  58. Physics

    In deep space, a small rock orbits an asteroid. The circular, orbit radius (between their center of masses) is 1037 m and the velocity of the rock is 8.02 m/s. Find the mass (kg) of the asteroid. G=6.67x10^-11 m^3/kgs^2. I got 1.0x10^15 but that is
  59. working with school-age children

    Which of the following is one of the steps for successful inclusion? 1) Use every inch of space in designated areas. 2)Organize all children in an assigned, designated area. 3) Modify appropriate environments and curriculum. 4)Provide every program
  60. Physics

    Cosmic microwave background radiation fills all space with an average energy density of 4 x 10^-14 j/m^3.(a) Find the rms value of electric field associated with this radiation.(b) How far from a 7.5 kW radio transmitter emitting uniformly in all direction
  61. Electromagnetic spectrum

    Some astronomical objects emit no visible light but are known through (blank?) and radio images; satellite observations (blank?) Earth's atmosphere help scientists study space at wavelengths that do not reach Earth's surface?
  62. Education

    The major emphasis of Movement programs for young children is the development of concepts. In what three major categories are they broken into? Body,space,time What , who, were Movement skill and fitness Awareness , knowledge and understanding I think it's
  63. Physics

    It has been suggested that cylinders rotating about their long axis with dimensions 19 km long and 6.9 km in diameter be placed in space and used as colonies. What angular speed must such a cylinder have so that the centripetal acceleration at its surface
  64. math

    air fare club offers membership at $300.00, at least 50 people must join.For every member over 50 their fare will be reduced by $2 for every member. Due to space limits only 125 passengers will be allowed. how many memberships will maximize the revenue?
  65. Chem

    The space probe Pioneer 11 was launched April 5,1973, and reached Jupiter in December 1974 traveling a distance of 998 million km. How long did it take an electromagnectic signal to travel to earth from Pioneer 11 when it was near Jupiter.
  66. Math

    Alex made a sketch for a homemade soccer goal he plans to build. The goal will be in the shape of a triangular prism. The legs of the right triangles at the sides of his goal measure 4 ft and 8 ft, and the opening along the front is 24 ft. How much space
  67. Math, physics

    A rotating space station has radius 1380 m, measured from the center of rotation to the outer deck where the crew lives. What should the period of rotation be if the crew is to feel that they weigh one-half their Earth weight?
  68. physics Classical Mechanics

    Consider a rocket in space that ejects burned fuel at a speed of vex= 1.5 km/s with respect to the rocket. The rocket burns 8 % of its mass in 280 s (assume the burn rate is constant). (a) What is the speed v of the rocket after a burn time of 140.0 s?
  69. physics

    A mover pushes a couch a distance of 4 m to the top of a ramp into the back of a truck using 500 N of force. A) What is the work input of the mover? B) What is the mover’s power if the task takes 10s? C) If the mass of the couch is 100 kg and the back of
  70. Calculus

    In a right triangle, the hypotenuse is of fixed length of 15 units, one side is increasing in length by 4 units per second while the third side is decreasing in size. At a certain instant the increasing side is of length 9 units. Find the rate of change of
  71. history

    can someone pleeease give me some helpful information, or some good points, with which i could answer this question. it will be veryyyy much appreciated. thank you compare the colonial empires of Spain, France and England in terms of their settlements,
  72. english

    4. Which of the following sentences contains a comma splice? A.The kitten climbed the drapes, it couldn't figure out how to get down. B.The cruise ship docked on Oahu, then again on Maui. C.We need help with organization, structure, and spelling. D.Our
  73. science

    explain the everyday phenomena in term of atomic structure and behavior when you lightly bump into a car, why does it dent and not create a hole? Although this is not my area of expertise, could there be some explanation in terms of molecular cohesiveness?
  74. home economics

    The economist for the Grand Corporation has estimated the company’s cost function, using the times series data to be TC=50+16Q-2Q2+0.2Q3 a. Plot this curve for quanties 1 to 10 b. Calculate the average total cost, average variable cost and marginal cost
  75. Spanish

    What is UOLSRRSEDELO unscrambled? The word is a spanish word and is written as: _ _ _(space) _ _ _ _ _ _ _ _ _ Thanks!
  76. Finite math

    Let S={1,2,3} be a sample space How many subsets of S contain the number 3? How many subsets of S contain either the number 2 or 3?
  77. finance

    You were hired as a consultant to Giambono Company, whose target capital structure is 40% debt, 15% preferred, and 45% common equity. The after-tax cost of debt is 6.00%, the cost of preferred is 7.50%, and the cost of retained earnings is 12.75%. The firm
  78. chemistry

    I have to draw the QMM of CL2C2. For the Lewis structure i think that the two C ayoms form a triple bond and the Cl atoms form single bonds. Therefore i think that the central C atom hybridizes into sp. if this is correct, my question is how do i know
  79. Math

    Tennis balls withal diameter of 2.5 in. Are sold in cans of three. The can is a cylinder. What is the volume of the space in the can not occupied by tennis balls? Assume the balls touch the on the sides,top and bottom.
  80. physics

    A laser that emits pulses of UV lasting 2.95 ns has a beam diameter of 4.05 mm. If each burst contains an energy of 4.60 J, what is the length in space of each pulse? What is the average energy per unit volume (the energy density) in one of these pulses?
  81. Physics

    A laser that emits pulses of UV lasting 2.95 ns has a beam diameter of 4.05 mm. If each burst contains an energy of 4.60 J, what is the length in space of each pulse? What is the average energy per unit volume (the energy density) in one of these pulses?
  82. science

    a satellite in force free space sweeps stationary interplanetary dust at a rate of dM/dt=alpha v, where M is mass and v is speed of satellite and alpha is a constant. the tangential acceleration of satellite
  83. Economics

    I have to do a housing project for economincs class. I have to pick a house. It has to include what kind of house it is and the square footage of the house and the square feet of the living space. Where would I search for this information
  84. RE

    i have to write a poem about 'your expression of the vastness of space/universe as a poem. i have all the ideas in my head about the universe being incredibly vast. but im rubbish at writing poems. Can anyone help or find a useful website that has a poem
  85. Geometry

    The Design for a Mural is 16 in. Wide and 9 in High. What are the Dimensions of the largest possible complete mural that can be painted on a wall 24 ft wide by 14 ft wide? And Can you Please Explain. I understood how to do it. but which height or width
  86. Math

    Find the sample space. a Bag contains 4 marbles: one each of red, blue, green and violet. Two marbles are drawn from the bag. assume that the first marble is not put in the bag before drawing the second marblle
  87. Grade 5 math

    At soap and suds there are 16 washing machines in a single row with no space between each one.Each washing machine is 75cm across.Wht is the total length of the 16 washing machines in centimeters and meters?
  88. Grade 5 math

    At soap and suds there are 16 washing machines in a single row with no space between each one.Each washing machine is 75cm across.Wht is the total length of the 16 washing machines in centimeters and meters?
  89. Earth/Space Science

    Cloud seeding, which causes rain by introducing condensation into a cloud, has been used to bring precipitation to areas experiencing drought. Analyze the benefits and risks of cloud seeding.
  90. Us history please help

    The] said Cooper Hughs Freedman with his wife...are to work on said farm and to cultivate forty acres in corn and twenty acres in cotton, to assist in putting the fences on said farm in good order and to keep them so and to do all other work on said farm
  91. Accounting

    Need help with this bank reconciliation...this is actually for a job and I am forgetting everything about accounting because I am nervous. BANK RECONCILATION ============================================== On Aug 14th, One of our Partner's ( Compuville )
  92. Grammar

    Determine if the following sentence is correct or incorrect. The patient had a difficult time recovering the wouldn's dressing. ANSWER: incorrect WHY - we ruled out that the ' is correct. Should there be a comma after time - or just bad sentence
  93. Cognitive psycology

    o Define language and lexicon. o Evaluate the key features of language. o Describe the four levels of language structure and processing. o Analyze the role of language processing in cognitive psychology
  94. Chemistry

    How do you find the number of valence electrons in a molecule? Do I need to use the Lewis structure diagram to find out? Please help! I need to the total number of valence electrons for SiH4, H2SO4, CCl4, BF3 and I don't know how!
  95. English

    1. She is fond of scuba diving. 2. She likes scuba diving. 3. She is afraid of snakes. 4. She fears snakes. 5. She is aware of the fact. 6. She knows the fact. (Is each pair the same in meaning? Do you have some more expressions which have the same
  96. Math

    The population of a city has been decreasing exponentially since 1990. In 1990, the population was 1,000,000. In 2010, the population was 560,000. If t represents time in years since 1990, which of the following equations best models the decay of the
  97. statistics

    .) A hospital in a large city records the weight of every infant born at the hospital. The distribution of weights is normally shaped, with a mea n µ= 2. 9 kilograms and a standard deviation o- = 0 .45. Determine the following: a. The percentage of
  98. Physics (please help!!)

    The Crab pulsar (m=2.00x10^30 kg) is a neutron star located in the Crab Nebula. The rotation rate of the Crab pulsar is currently about 30.0 rotations per second, or 60.0pi rad/s. The rotation rate of the pulsar, however, is decreasing; each year, the
  99. Basic Finance

    Suppose we observe the following rates: 1R2= 8%, 1R2= 10%. If the unbiased expectations theory of the term structure of interest rates holds, what is the 1-year interest rate expected one year from now, E(2r1)?
  100. MATERIAL SCIENCE

    1. Calculate the theoretical density of Barium metal barium 2. Calculate the theoretical densities and packing factor of barium zirconate (BaZrO3), and barium cerate (BaCeO3), both of which form the perovskite structure