In the product F = qv · B , take q = 4, v = 2.0i + 4.0j + 6.0k and F= 136i -176j + 72k. What then is in unit-vector notation if Bx = By? I still can't get

7,930 results
  1. MATH HELP

    The cost to produce a product is modeled by the function f(x) = 5x^2 − 70x + 258 where x is the number of products produced. Complete the square to determine the minimum cost of producing this product. 5(x − 7)^2 + 13; The minimum cost to produce the

  2. math

    Find the product of √30 and 6√10. Express it in standard form (i.e., a√b. Enter the product of the coefficients followed by the product of the numbers under the square roots separated by a comma. How I solve for it 1*30=30 and 36*10=360 so my is

  3. maths

    the sum of N positive integers is 19. what is the maximum possible product of these N numbers? thx. Nice problem. Let's look at some cases 1. N=2 clearly our only logical choices are 9,10 for a product of 90 It should be obvious that the numbers should be

  4. Algebra 2

    What is the product of a complex conjugated? The product of complex conjugates is a difference of two squares it is always a real number. The product a complex conjugates may be written in standard form as a + bi where neither a nor b is zero. The product

  5. Chemistry

    Given the reaction: Cu2+(aq) + S2-(aq) CuS(s) What will happen (a) if CuSO4(aq) is added? And (b) if Na2SO4(aq) is added? A. (a) Nothing; (b) Less product will form B. (a) Less product will form; (b) Nothing C. (a) Nothing; (b) More product will form D.

  6. Algebra

    Which statement about the product is true? 5.5 Square Root 5 A)The product is rational. B)The product is irrational. C)The product is neither rational nor irrational. D)There is not enough information provided to answer the question. My Choice is B.

  7. math- im really confused! please help!!

    A company makes three products X, Y and Z. Each product requires processing by three machines A, B and C. The time required to produce one unit of each product is shown below. Product X:- Machine A: 1 Machine B: 2 Machine C: 2 Product Y: Machine A:2

  8. math

    check my answers 1. -23 x 5 my answer is -115 2. -8 x 15 my answer is -120 3. 75 x 6 my answer is 450 4. 12 x -7 my answer is -84 5. -24 x -20 my answer is 480 6. -130 x 7 my answer is -910 7. which has a product of 170 my answer is -85 x -2 8. which has a

  9. ms.sue math

    Which sum will be irrational? a. 3 + 2 b. √19 + 7/2 ****** c. 18/3 + 11/10000 d. –6 + (–3.251) Which product will be rational? A.17.12 * 33 ***** B. √ of 3 * √ of 9 C.4*pie D.- √ of 20 * 15 A whole number is added to a number with two digits

  10. chemistry

    Please judge my answer Question:A solution of AgNO3 (45 mL/0.45 M) was mixed with solution of NaCl (85 mL/1.35 x 10-2 M) a) Calculate the ion product of the potential precipitate. b) Would a precipitate form? The Ksp of AgCl(s) is 1.8 x 10-10. Answer: For

  11. algebra

    1.If a number a is always less than another number b, which of the following expressions expresses their relationship? A.a≤b B.a≥b C.a>b D.a0 D.x9 Which of the following sentences is the word equivalent of the expression above? A.The product between 3

  12. Mico- Econ-- Help

    A change in the quantity demanded of a product is the result of a change in __________. the price of the product the price of related goods consumer income the cost of producing the product I say the 3rd

  13. Check my answers MATH

    Which statement about the product is true? 5.643 times 4 point ModifyingAbove 6 with bar The product is irrational. The product is neither rational nor irrational. The nature of the product cannot be determined. The product is rational. Which of the

  14. maths

    James is able to sell 15 of product A and 16 of product B and a week , Sally is able to sell 25 of product A and of 10 product B a week,and Andre is able to sell 18 of product A and 13 of product B a week.if product A sells for $35.75 each and product B

  15. ALGEBRA

    which of the following are reasonable answer for the product of two negatives and a positive a. 20** b. 10 c. -20 d. -10 Which statement about the product is true 5.5⋅√5 a. The product is rational b. The product is irrational**** c. The product is

  16. marketing

    : You are working in the product development department of a company that creates household products. Your team has come up with an idea for a revolutionary new cleaning product. Using the seven phases of new product development as a guide, describe how

  17. math

    which of the following are reasonable answer for the product of two negatives and a positive a. 20** b. 10 c. -20 d. -10 Which statement about the product is true 5.5⋅√5 a. The product is rational b. The product is irrational**** c. The product is

  18. Algebra 2

    Operations with complex numbers What is the product of complex conjugates? The product of complex conjugates is a sum of two squares and is always a real number. The product of complex conjugates may be written in standard form as a+bi where neither a nor

  19. Macroecon

    An increase in supply of a product results when __________. : taxes on the product are increased the companies that produce the product have higher materials costs technological innovations are introduced in the manufacturing process the government reduces

  20. algebra 1

    Which statement about the product is true? 7.56*6.7 ̅? a)the product is irrational b)the product is rational** c)the product is neither rational or irrational d)the nature of the product cannot be deterined

  21. algebra 1

    Which statement about the product is true? 5.5 square root of 5 A. The product is rational B.the product is irrational** C.the product is neither rational or irrational D.there is not enough information provided to answer the question Which of the

  22. Entrepreneurship

    1. If a product becomes more easily available, what is likely to happen? A) The product will get more competitors. B) The cost of making the product will increase. C) The product will become a consumer good. D) The price will go down. Is the answer D? I'm

  23. statistics

    2. Suppose that the average product of labor increases as more workers are hired. Which of the following must be true? a. Marginal product is greater than average product. b. Marginal product is increasing. c. Marginal product is decreasing. d. Marginal

  24. Macroeconomic

    Suppose that a market for a product is in equilibrium at a price of $5 per unit. At any price above $5 per unit. A. There will be an excess demand for the product. B. There will be an excess supply of the product. C. The quantity supplied of the product

  25. Linear Programming

    We produce two products: product 1 and product 2 on two machines (machine 1 and machine 2). The number of hours of machine time and labor depends on the machine and the product as shown in Table 64. The cost of producing a unit of each product is shown in

  26. math

    Find the two numbers that multiply to the product number and add to the sum number of the following: a)Product 563033256; Sum 51895 b)Product -43481220; Sum 28429 c)Product 2545124358; Sum -105619 I tried xy = product and x+y = sum, but it didn't work

  27. Math

    The nutritionistof FLC Foods, Inc. designed a new product for everybody's consumption and believes that the variable cost in producing the said product is Php950.00 per unit and the fixed cost is Php60,000. Write the total cost as function of the product

  28. AP Biology

    After an enzyme is mixed with its substrate, the amount of product formed is determined at 10-sec intervals for 1 min. Data: 0 secs. = 0.0 product formed (mg) 10 secs = .25 product formed (mg) 20 secs = .50 product formed (mg) 30 secs = .70 product formed

  29. marketing

    There are four Ps in marketing. These are Price, Product, Promotion, and Place. Choose a product or service with which you are familiar. Describe the product or service. Then, in your own words, describe the 4-P decisions which would be important when

  30. Microeconomics

    Use the following chart to answer question 2 Number of Workers Total Product Marginal Product 0 0 -- 1 10 10 2 10 3 28 4 34 5 5 6 42 2. Refer to the above data. The marginal product of the third worker: A) is 6. B) is 7. C) is 8. D) is 9.

  31. Physics

    2. We have two vectors that line in the x-y plane. If we take the cross-product of those two vectors we know that a. the magnitude of the cross-product will always be equal to the product of the magnitudes of the two vectors. b. the magnitude of the

  32. Biology

    How do you balance equations? http://www.chemistry.ohio-state.edu/betha/nealChemBal/ The reactants are written on the left and the products on the right.An arrow pointing towards the product is inserted between the reactant and product.The number of

  33. Math

    There are 4 odd functions and 3 even functions in the gallery of the 12 basic functions. After multiplying these functions together pairwise in different combinations and exploring their graphs, make a conjecture about the summetry of: A) a product of 2

  34. Business Law- Need Help with this one..

    In trademark terms, what is acquiring secondary meaning? A. when a mark that resembles a mark already registered with the federal PTO is used for a new product or service B. when descriptive words are used that have no direct relevance to a product or

  35. Math

    If we multiply "a" and "b",when will: a. the product be larger than both "a" and "b"? b. the Product be less than "a"? c. the product be less than "b"? d. the product be less than"a" and "b"? e. the product be greater than "a"? f. the product be greater

  36. Managerial Accounting

    The overhead rate for materials handling is $10 per part based on an estimated total cost of $900. Products X & Y have 320 and 280 parts respectively. What is the overhead allocated to X & Y? A. Product X $3,200, Product Y $4,400 B. Product X $4,800,

  37. retail pharmacy assistant

    when a customer askes for a product by name the pharmacy assistant must ? a.ask the customer what the product is for b.supply the product without any questions c.ask the pharmacist if the product is safe d.suggest in conversation the possible uses of the

  38. MATH

    HELP HELP The sum of the product of 16 and x and the product of 11 and y is 218. The difference of the product of 5 and x and the product of 11 and y is -134. What are the values of x and y? PLS

  39. economics

    Assume that demand for product A can be expressed as QA = 500 ¨C 5PA + 3PB and demand for product B can be expressed as QB = 300 ¨C 2PB + PA. Currently, market prices and quantities for these goods are PA, = 5, PB = 2, QA = 481, and QB = 301. a. Suppose

  40. Math

    Which statement about the product is true 5.643 x 4.6666666.....(Repeating) A. The product is irrational B. The product is neither rational nor irrational C. The nature of the product cannot be determined D. The product is rational***

  41. Accounting

    Cambridge Manufacturing Company, Inc. has 200 labor-hours available. There is no limit on machine hours. Cambridge can sell all of Product B that it wants, but it can only sell 30 units and 20 units of Products A and C, respectively. Product-A Product-B

  42. MATH

    A company makes three products X, Y and Z. Each product requires processing by three machines A, B and C. The time required to produce one unit of each product is shown below. Product X:- Machine A: 1 Machine B: 2 Machine C: 2 Product Y: Machine A:2

  43. MATH-PLEASE HELPPP!!!!

    A company makes three products X, Y and Z. Each product requires processing by three machines A, B and C. The time required to produce one unit of each product is shown below. Product X:- Machine A: 1 Machine B: 2 Machine C: 2 Product Y: Machine A:2

  44. MATH- please help!

    A company makes three products X, Y and Z. Each product requires processing by three machines A, B and C. The time required to produce one unit of each product is shown below. Product X:- Machine A: 1 Machine B: 2 Machine C: 2 Product Y: Machine A:2

  45. Business Management

    I have just came across the words product-led and market-led and have no idea what they mean, could someone please give me a detailed explanation thanks Thank you for using the Jiskha Homework Help Forum. Look at "market-led" as "what the customer wants."

  46. Product curves

    If the short run total product curve is a linear function of the variable input over some range of values. Describe the shape of the marginal product and average product functions. I am guessing that the marginal product is constant, which a horizonal

  47. math

    Hi There- I really need help with this. I'm kind of confused and don't have an answer. if you could explain it ill give you my answer once I understand it. how does the product of a fraction and a whole number compare to the whole number? A. the product is

  48. math,help

    a company is taking a survey to find out whether people like its product. Their last survey indicated that 70% of the population like the product. based on that, of a sample of 58 people, find the probability of the following. a) all 58 like the product.

  49. Advertising research: theory and practice

    James wants to change the creative strategy in order to make consumer think differently about his product. He wants the product to be viewed as a product for sports enthusiasts. In order to do this, he must: a. conduct demographic research b. reposition

  50. marketing

    You are working in the product development department of a company that creates household products. Your team has come up with an idea for a revolutionary new cleaning product. Using the seven phases of new product development as a guide, describe how your

  51. Marketing

    you are working in the product development department of a company that creates household products. Your team has come up with an idea for a revolutionary new cleaning product. Using the seven phases of new product development as a guide, describe how your

  52. marketing

    You are working in the product development department of a company that creates household products. Your team has come up with an idea for a revolutionary new cleaning product. Using the seven phases of new product development as a guide, describe how your

  53. law of torts

    In order to prove that a product is unreasonably dangerous, a plaintiff's lawyer may: Hire an expert. Analyze the product warning. Demonstrate the product for the jury. Talk to other users of the product. All of the above. all the above? or hire an expert?

  54. Algebra PLEASE HELP ASAP MS.SUE PLEASE HELP

    Which statement about the product is true? 5.5 square root of 5 A. The product is rational B.the product is irrational C.the product is neither rational or irrational D.there is not enough information provided to answer the question Which of the following

  55. economics

    when the MP of a given variable input is declining but positive a.total product is decreasing at incrising rate. b.total product is incrasing but at the deacrising rate. c.avrage product is more than the marignal product d.a&c e.b&c

  56. Marketing Principles

    Motivating and Leading The following are the four P's in marketing: Price Product Promotion Place Complete the following below: Choose a product or service with which you are familiar. Describe the product or service. In your own words, describe why and/or

  57. business studies

    what does product diversification mean? Look at General Electric, they have a tremendously diverse product output. Not producing only one product, but many different products, e.g. conglomerate.

  58. Statistics - math

    Each consumer has a 25% chance of preferring your product over the competitor's product. If we question 15 customers, what is the probability that at least 3 will prefer your product?

  59. CHEMISTRY

    When 10.8 g of Silver was reacted with Sulfur, 12.4 grams of product was produced (there was only one product). What is the empirical formula of the product?

  60. tourism and hospitality

    Positioning, or branding, is the creation of ________________________________. an image for a product in the minds of costumes the product the value of the product all of these b?

  61. material engineering

    I need help for this product. beverage can (e.g;for fizzy drinks).. for this product : 1- What is the appropriate metal for the manufacture of this product.? 2- How can we choose the right manufacturing process? 3-Which material selection charts I must

  62. Math

    Carmike Company can further process Product A to produce Product B. Product A is currently selling for $25 per pound and costs $10 per pound to produce. Product B would sell for $32 per pound and would require an additional cost of $10 per pound to

  63. maths!

    6) There are three research and development projects focusing on the development of three new products A, B and C. The markets into which the new products are to be launched are identical. However, consumer preference is at present, unknown. A probability

  64. Business

    Choose a product you wish to market. You will follow this product through all four P's of Marketing. Describe your goal. Is it to maximize quantity, market penetration, market share, gross revenue, profit, or other goal (such as social change)? In your one

  65. chemistry

    7.25 g of iron were reacted with sulfur until the product reached a constant mass of 13.50 g. If the experimental molecular mass of the product was measured as 572 u, what is the molecular formula of the product? What is the actual molecular mass of the

  66. chemistry

    7.25 g of iron were reacted with sulfur until the product reached a constant mass of 13.50 g. If the experimental molecular mass of the product was measured as 572 u, what is the molecular formula of the product? What is the actual molecular mass of the

  67. marketing

    I need a better understanding please. Do you know a commercial I could use Think of a product that you have seen advertised on television, a magazine, or on the radio. Describe the product and identify two external influences that might lead a person to

  68. economics

    Suppose that a business has developed a very high-quality product and operates more efficiently in producing that product than any other potential competitor. As a consequence, at present it is the only seller of this product, for which there are few close

  69. math

    Determine the extension amount of the following order: Product X: 10 units @ $2.35 each Product Y: 12 boxes @ $6.15 per box Product Z: 3 dozen @ $12.20 per dozen (Points: 5) $20.70 $133.90 $172.50 $536.50

  70. Chem Help Please!

    You are carrying out a chemical process according to the equation below. If product C, which is the desired product can decompose to product F, how might you ensure that you stopped the reaction at the optimum point to ensure the maximum yield of C.

  71. Microeconomis

    Why is much more profitable for a company to bring to market a new product than secon? While your statement is generally true, it is not always true. The producer of a new product MAY enjoy some monopoly power for a time. Makers of an existing product are,

  72. English

    The most effective way of controlling the quality of a product is by _______________________________. controlling the processes that make the product disciplining workers for less-than-excellent output examining the end product and correcting any flaws A?

  73. social studies

    i have a project to do on entrepreneur activity.I have to create a product that people will want to but during the time period of 1400-1600. And create a product product that someone would want to invest in to a joint-stock company. I want to used a

  74. algebra

    A number, greater than or equal to 2, is called product-perfect if it is equal to the product of all of its proper divisors. For example, 6=1×2×3, hence 6 is product perfect. How many product-perfect numbers are there below 50?

  75. math

    A firm develops a new product that will add Rs.50,000 to product. Each year for 5 years. If the discounted 10%. How much will new product add to share holder value?

  76. cost accounting

    market a new product for 2.00 a unit. fixed costs to manufacture this product are 100,000. the contribution margin is 40 percent. how many units must be sold to realize net income of 100,00 from this product?

  77. Healthcare

    choose a product or service category that is at each stage of the product lifecycle--one each for introduction, growth, maturity, and decline. Explain your selection Propose strategies for effectively marketing each product or service you selected.

  78. chemistry

    what product is obtained by reacting methylamine with salicylaldehyde in a 1:1 ratio? This is related to your other about salicylaldehyde. The product is an imine and the other product is water.

  79. Organic Chem

    A LITTLE CONFUSED...QUESTION ASKS THE REAGENT SHOWN IS ADDED TO THE COMPOUND, WHAT SHOULD YOU SEE WHEN THE TWO MATERIALS ARE MIXED TOGETHER? IS THE ANSWER THE PRODUCT OR THE REACTION, LIKE HEAT OR COLOR CHANGE. AND IF ITS PRODUCT IM CONFUSED? PLEASE HELP.

  80. chemistry -3.2.4

    Given the reaction: Cu2+(aq) + S2-(aq) CuS(s) What will happen (a) if CuSO4(aq) is added? And (b) if Na2SO4(aq) is added? A. (a) Nothing; (b) Less product will form B. (a) Less product will form; (b) Nothing C. (a) Nothing; (b) More product will form D.

  81. chemistry

    Given the reaction: Cu2+(aq) + S2-(aq) CuS(s) What will happen (a) if CuSO4(aq) is added? And (b) if Na2SO4(aq) is added? A. (a) Nothing; (b) Less product will form B. (a) Less product will form; (b) Nothing C. (a) Nothing; (b) More product will form D.

  82. Check Answers (Math)

    1. Which binomial is a factor of x^3-3x^2-28x? A. x-4 B.x^2-4 C.x-7*** x^2-7 2. A company's profit is described by the equation. P(x)=-5^2+300x+15,000. Where x is the price in dollars that the company charges for its product. What should the company charge

  83. Marketing

    Select a product or service that you would like to introduce to the marketplace. It may be a product or service from an existing company or a new concept. · Prepare a 1750-2100 word Marketing Plan for your selected product/service. Include the following

  84. medical billing and coding

    choose a product you bought within the last month from a clothing or shoe store, describe how the four factors contributed to the elasticity of the good, is the product elastic, unitary or inelastic, in a few sentences what effect does the current supply

  85. marketing

    Select a product or service you would like to introduce to the marketplace. It may be from an existing company or a new concept. Prepare a 1,750- to 2,100-word marketing plan for your selected product or service. Include the following elements: A brief

  86. pre alegra

    A product that cost 2,000 increase by 5% in June. The new June price of the product increased by 5% on December 1st. How many dollars did the product increase by Dec 1. I don't have a clue! Can you please help

  87. science

    ok so plse heko me i have to come up with some examples of chemicals changes and identify the product and the reactent. i need three more i already have these two you start out with a egg (reactant) and then it gets burnt (product) you have a pile of wood

  88. A and P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? What is its mRNA nucleotide sequence? Indicate the product of this DNA segment/gene. What is the product’s

  89. U.S. Gov. & Ec.

    The United States government puts high tariffs on a certain product that is imported from other countries. What effect does this have in the United States? A. U.S. producers have to compete more with the imported product. B. High tariffs create a greater

  90. O.Chem

    Only a substitution product is obtained when the compound 1-bromo-2,6-dimethylcyclohexane is treated with sodium methoxide. Draw the substitution product and explain why an elimination product is not obtained.

  91. marketing

    I need a better understanding please. what is 2 external influences? Think of a product that you have seen advertised on television, a magazine, or on the radio. Describe the product and identify two external influences that might lead a person to purchase

  92. A&P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? 1A. What is its mRNA nucleotide sequence? AGCCCGAUGUUUUGUUUAGUUGCCCCGAGCGUUUGUUUAUUUGCC 1B. Indicate the product

  93. Cost Accounting Please explain how to do the probl

    Can someone please explain how to do the following? Baxter Company manufactures two products, Product F and Product G4. The company expects to produce and sell 2,600 units of Product F and 6,000 units of Product G during the current year. The company uses

  94. Statistics

    A manufacturer has observed that a certain product tends to fail either very early in its life span or quite late. The engineers are interested in studying a particular product going into cellular phones. They know that the average life span of the product

  95. A L G E B R A H ELP MS SUE.

    I THINK I MAY HAVE DONE MY HOMEWORK WRONG BECAUZE IT SAYS TO : ESTIMATE THE PRODUCT OR QUOTIENT. SO WOULD THAT MEAN TO ACTUALLY DO WORK THEN ESTIMATE THE PRODUCT OR QUOTIENT LIKE FIRST -72 X 57 = -4104 OR ESTIMATE; -4000 ? I AM CONFUSED ABOUT WHAT IM

  96. Organic Chemistry

    The reaction of (Z)-butenedioic acid (fumaric acid) with butadiene sulfone gives only one product. Draw the product of this reaction and explain why only one product forms

  97. accounting

    a drug company has a monopoly on a new patented medicine. the product made in either of two plants the cost of production for the two plants are MC1=10+2Q1 and MC2=25+5*Q2. the firms estimate of demand for the product is p=2000-3(Q1+Q2). how much should

  98. economics

    # Choose a product you have purchased in the past month from a grocery or home improvement store. # Describe how each of the 4 factors contributed to the elasticity of the good. # Is the product considered elastic, inelastic, or unitary elastic? # In a few

  99. Finance

    The manager for a growing firm is considering the launch of a new product. If the product goes directly to market, there is a 40 percent chance of success. For $171,000, the manager can conduct a focus group that will increase the product’s chance of

  100. Geography

    What is it mean when it says "Your task is to create a digitl product, that helps explain your personal culture. Use the following : Appearance, Beliefs, Communication, Dates, Entertainment, Food, Government, Housing, Information, Jobs, Kind of

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20