1. Algebra

    One number is 58 more than twice another. Their product is 58 more than twice their sum. Find the numbers.
  2. math

    number sense . is the product of 4 x 8,827 less than 36,000? how do you know ?
  3. Math

    Write the inequality and solve: The product of a number and 7 is less than 28
  4. math

    translate to an algebraic expression the product of 27% of some number
  5. geometry

    What inequality represents the sentence below? The product of a number and 5 is no more than 8. A. 5n < 8 B. 5n > 8 C. 5n>8 D.5n<8
  6. algebra

    what inequality represents the sentence below? The product of a number and 5 is no more than 8.
  7. 5th grade math

    The sum of 6 and the product of 7 and a number is 75
  8. math

    The product of 8 and twice a number is 3. What would that translate to if you were to write it out as an equation?
  9. math

    the product of seven and four times a number multiplied by three 28*n*3 is this correct??
  10. math need help please

    Translate to an algebraic expression The product of 19% and some number
  11. Algebra

    How do I translate to algebraic experssion. The product of 26% and some number?
  12. Math

    Which shows the product of a number n and 12? A.n-12 B.n/12 C.12n D.n+12 Is the answer D?
  13. algebra

    Writing expressions with variables One more than the product of three and a number x
  14. math

    The number of non-zero digits in the product of 4000 and 3000 is?
  15. algebra

    One number is 10 more than twice another.Their product is 10 more than twice their sum.Find the numbers.
  16. mothergooze

    Fourteen subtracted from the product of 3 and a number equals 28
  17. Math

    Write an algebraic expression for 4 less than the product of 2 and a number. 4-(2a)
  18. algebra

    Write an expression to represent: Seven more than the product of one and a number x.
  19. mathematics

    If a and b are positive integers, a+b<20, and the product of ab is an even number, what is the largest possible value of a?
  20. calculus

    What is the largest possible product of two negative number whose sum is 1?
  21. managerial economics

    Explain the relationship between product X, product Y and product Z or the properties of each according to the following statements a. Cross price elasticity between X and Y is -4 b. Cross price elasticity between X and Y is 12 c. Cross price elasticity
  22. PreAlgebra

    A circular pond 20 m in diameter is surrounded by a gravel path 5 m wide. The path is to be replaced by a brick walk costing $30 per square meter. How much will the walk cost? i need to teach this to my brother, but i'm stuck on it myself. please show me
  23. math

    Write the ratio of the number of squares to the number of circles as shown below. (Pretend I have four circles and five squares. The # will represent circles and the @ sign will represent squares.) #### @@@@@ (A)4 to 9 (B)5:4 (C)4 to 5 (D)5:9 I think the
  24. Math

    Write the ratio of the number of squares to the number of circles as shown below. (Pretend I have four circles and five squares. The # will represent circles and the @ sign will represent squares.) #### @@@@@ (A)4 to 9 (B)5:4 (C)4 to 5 (D)5:9 I think the
  25. physics

    compute the kinetic energy of an 1800 lb automobile traveling at 30 mi/hr. how many times as great is the kinetic energy if the velocity is doubled? compute the kinetic energy, in erg and in joules, of a 2 gram bullet travelling at 500 m/sec.
  26. science

    ok so plse heko me i have to come up with some examples of chemicals changes and identify the product and the reactent. i need three more i already have these two you start out with a egg (reactant) and then it gets burnt (product) you have a pile of wood
  27. Organic Chemistry

    The reaction of (Z)-butenedioic acid (fumaric acid) with butadiene sulfone gives only one product. Draw the product of this reaction and explain why only one product forms
  28. Math

    Hi, I have a question regarding simplifying the following expression: (1/x)/((1/3)x^(-2/3)) = 3/3sqrtx The last expression reads three over cube root of x. I don't understand how to get from the expression on the left side of the equal sign to the one on
  29. college algebra

    Suppose that the number of new homes built, H, in a city over a period of time, t, is graphed on a rectangular coordinate system where time is on the horizontal axis. Suppose that the number of homes built can be modeled by an exponential function, H= p *
  30. Statistics

    2. Given the cumulative distribution function (cdf) F(x)=(0 x<4 (x-4)/4 4 <= x <8 1 x >=8 2.1 Using the cdf, compute P(5<X<6). 2.2 What is the pdf of X? 2.3 Using the pdf, compute P(X<7). 2.4 What is E(X)? 2.5 What is V(X)?
  31. physics

    I have a Pressure in atm and a volume in liters how do i find the temperature in kelvins?? I know the formula pv=nRT works...but i don't know the number of moles so... I don't know what to do.
  32. English

    Don't use plastic bags to save the environment. ============ What is the meaning of 'save' here? what other words can we use instead of 'save'?
  33. English

    Type the prepositional phrase in the box. The Grand Canyon is in Arizona. i put (in) an i got it wroung and then i put (the) and got that wroung THEN i put (is in)
  34. ALGEBRA 1

    CAN SOMEONE PLEASE CHECK TO SEE IF I HAVE DONE THESE CORRECTLY. Thanks for your help. Solve by completing the square 1. X^2-6x=16 X^2-6x + (-6/2) ^2=16+ (-6/2) ^2 X^2-6x+36/4= 16+36/4 (X-6/2)=100/4 X-6/2= +or - 10/2 X=6 + or - 10/2 X=-4, X=8 2. 2x^2-3x+1
  35. math

    I am a two digit number, twice the sum of my digits is 22. The product of my digits is 24.My tens digit is greater than my ones digitwhat number am I?
  36. physics

    An electron ( mass = 9.11×10−31 kg) leaves one end of a TV picture tube with zero initial speed and travels in a straight line to the accelerating grid, which is 1.85 cm away. It reaches the grid with a speed of 2.95×10^6 m/s . (You can ignore the
  37. algebra - please help

    Let N(t) be number of bacteria after t days. N(t) = Pa^t for some constants P and a. N(2) = 5400 and N(6)=382,000. a)before working problem, estimate value of N(5). b) write down 2 equations for P and a, one when t=2 and one when t=6, and use these two
  38. ALGEBRA

    can you help me with this. d don't get it at all :( let n be the number used for the given number puzzle. use algebra to show how the puzzle works. 1. pick a number 2. subtract 9 3. multiply by 6 4. divide by 3 5. add 18 6. subtract twice your original
  39. Biology

    Explain why ice forming within a living organism may result in its death. Candice/ Michelle (Whoever you are) I think if you read the link I left above for you, it will be clear. Hint* If ice expands when it freezes and the cell wall/membrane can't
  40. Psychology

    What approach to therapy would be used by a therapist who teaches a deaf child to sign "help" by rewarding him each time he makes the sign? Cognitive Biological Behavioral Psychodynamic Humanistic I'm torn between behavioral and cognitive.
  41. Algebra

    A stop sign has the shape of an octagon with each side measuring 0.5 ft. To make a scale model of the sign, every dimension is multiplied by 1/20. How is the ratio of the areas related to the ratio of the corresponding dimensions? What is the ration of the
  42. figurative language

    plz help me i am in 5th grade and need help on similies & metaphores about the book number the stars. it asks "it was an odd word: pride." meaning proud, i think
  43. English

    Read the passage below and answer the question: Jack: I’ll be there in 20 minutes. I’m stopping at the store to pick up some batteries. Do you need anything? Mike: Will you buy some coffee for me? I’ll pay you back when you get here. Which statement
  44. MATH HELP

    What is the simplified form of the expression? Hint: Combine like terms 7m2 + 6.5n – 4n +2.5m2 – n A)9.5m2 + 1.5n B)4.5m2 + 1.5n C) 9.5m2 – 1.5n Which property is illustrated by the statement? 8 + 3.4 = 3.4 + 8 A)Associative Property of Addition B)
  45. Technology

    1. What function would you use to find the mean in a microsoft(R) excel document A. ROUND B. AVERAGE •• C. SUM D. HYPERLINK 2. What is the first thing you should do to find the mean and range of data? A. put the numbers in order from least to greatest
  46. Economics: Comperative Advantage

    Refer to Figure 4. Assume that Cliff and Paul were both producing wheat and corn, and each were dividing their time equally between the two. Then they decide to specialize in the product they have a comparative advantage in. As a result, total production
  47. technoligy

    1. What function would you use to find the mean in a microsoft(R) excel document a=ROUND b=AVERAGE c=SUM d=HYPERLINK 2. What is the first thing you should do to find the mean and range of data? a=put the numbers in order from least to greatest b=count the
  48. Education and technology

    1. What function would you use to find the mean in a microsoft(R) excel document a=ROUND b=AVERAGE c=SUM d=HYPERLINK 2. What is the first thing you should do to find the mean and range of data? a=put the numbers in order from least to greatest b=count the
  49. physics , math

    The hydrostatic equation holds not just for air, but for other fluids such as water (air, though it is a gas, is often referred to as a 'fluid') as well. In the case of water the equation becomes even easier, as water (as opposed to air) can be treated as
  50. technoligy

    1. What function would you use to find the mean in a microsoft(R) excel document a=ROUND b=AVERAGE c=SUM d=HYPERLINK 2. What is the first thing you should do to find the mean and range of data? a=put the numbers in order from least to greatest b=count the
  51. technoligy

    1. What function would you use to find the mean in a microsoft(R) excel document a=ROUND b=AVERAGE c=SUM d=HYPERLINK 2. What is the first thing you should do to find the mean and range of data? a=put the numbers in order from least to greatest b=count the
  52. grammar English

    I am writing about interviewing Deaf Persons for my ASL research paper. The first person is Christian DeGuzman. He is profoundly deaf since birth, and about 2 or 3 years old later they found out that he was deaf that’s why. Christian grew up in Bay Area,
  53. English

    Which of these words has the same denotative meaning a, but a different connotative meaning than, the word COPIOUS. A. meager B. abundant C. lavish ******* D. sparse An award is given every year to the student ______ has the highest grade-point average.
  54. Life Skills

    We have to do one page about our history. I don't have any ideas what to put though. Can anyone give me some suggestions?
  55. History

    I need 2 write a paper on the Renaissance but i don't know what to put in my outline. can some1 give me an example,please? thank you.
  56. math

    write 66 2/3% as a fraction simplest form what i did: i put 66 2/3 over 100. i don't know how to divide that
  57. Physical Science

    Water boils at _______ 01 Kelvin. I put 373.15 but I don't know if it is right. Could someone please help me?
  58. English

    I am writing an essay on honor killing and i don't know what to put for my "call for action?" PLEASE HELP
  59. English

    I'm sorry to ask this again but I still don't know what to put as examples of hope and hopelessness from Act One in A Raisin in The Sun
  60. Math

    Actually, i made a mistake. All though we still came up with the right answer, I made a mistake and copied another book answer to another question into this question. The real book answer to this word problem is: ( Let's translate the English into Math:
  61. English (Check)

    The word root -vid-, from the Latin "videre," means "to see." Explain how each word that follows conveys the meaning of the root. 1. videotape 2. evident A: 1. This word conveys the meaning of the root as it refers to a magnetic tape for recording and
  62. English (Check)

    The word root -vid-, from the Latin "videre," means "to see." Explain how each word that follows conveys the meaning of the root. 1. videotape 2. evident A: 1. This word conveys the meaning of the root as it refers to a magnetic tape for recording and
  63. trig

    how do i evaluate using formulas? i did almost the entire thing, but i can't finish the problem because i don't know how to simplify it: tan(-5/12pi) i can get until this part: = (-6pi/24)+(4pi/24) / 1-(-2pi/24)
  64. economics

    a firm is planning to manufacture a new product. the sales department estimates the quanity that can be sold depends on the selling price. as the selling price is increased, the quantity that can be sold decreases. they estimate: P=$35-0.02Q where
  65. economics

    a firm is planning to manufacture a new product. the sales department estimates the quanity that can be sold depends on the selling price. as the selling price is increased, the quantity that can be sold decreases. they estimate: P=$35-0.02Q where
  66. math. HOW DO I CONVERT A DECIMAL TO A FRACTION

    how do i convert a decimal to fraction in SIMPLEST FORM? a) -2.756 ?? Write out the 0.756 as 756/1000, then reduce it to lower terms if you can. Since both numerator and denominator are evenly divisible by 4, 756/1000 can be reduced to 189/250. The mixed
  67. English

    just reposting this in neater form I had a question today in class it was "Please explain the main point that the character Bill has use evidence from the text to support that." In one of my sentences I placed "Bill said "Thats because some people feel
  68. Math/Pre Algebra HELP ME!

    1. What are the coefficients in the polynomial 5x^2 + 2x - 4? A. 5,2 B. -5,2 C. 5,2,-4 ** D. 5,-2,-4 For questions 2 and 3 add or subtract. 2. (m^2 - m - 4) + (m - 5) A. m^2 - 2m + 9 B. m^2 + 2m - 9 C. m^2 - 2m - 9 ** D. m^2 - 9 3. (5x^2 + x - 3) - (-2x^3
  69. GENERAL CHEMISTRY

    CALCULATE THE pH AND HYDROLYSIS IN 0.10 M AlCl3 SOLUTION.Ka = 1.2 X 10-5 FOR [Al(OH2)6]+3,OFTEN ABBREVIATED Al+3.TELL WHETHER pH IS ACID OR BASE.GIVE IONIC EQUATION. Help us a little by telling us how much you know to do and exactly what you don't
  70. civics

    1. Every month congress passes public work bills. I put true 2.In a roll call vote,is a speaking vote to decide if a bill should be added. I put false 3.A standing vote is when those in favor of a bill stand up and explain why they think it should be
  71. math

    Can someone please help me? I don't know how to work this out, and my friends don't either. Eight hot dogs and ten buns come in separate packages. a. Is the number of hot dog packages proportional to the number of hot dogs? Explain. b. Is the number of hot
  72. Database Design (SQL)

    I ned help creating a query that shows the number of days left before the end of the term. I need the following functions to accomplish this: CONCAT, DAYOFYEAR, NOW. So far I have this for my query: SELECT CONCAT('There are ',DAYOFYEAR(NOW()),'
  73. Math

    I am thinking of a numbet. If you add 3, then subtract 6, then divide by 2, and finally multiply by 4, the result is -8. What is the number
  74. Math

    She added 4, multiplied the sum by -5, and subtracted 12. She then doubled the result and got -34. What number did Christa started with???
  75. Math

    Which number will have the same result, when rounded to the nearest ten or hundred? Is it 97, 118 and 5, 179 or 5,091?
  76. math

    One number is eight more than twice another. If their sum is decreased by nine, the result is fourteen. Find the numbers....smaller value and larger value
  77. Math

    She added 4, multiplied the sum by -5, and subtracted 12. She then doubled the result and got -34. What number did Christa started with?
  78. Maths

    A positive two digit number is divided by the sum of its digits. What is the smallest and largest the result can be?
  79. math

    which number will have the same result, when rounded to the nearest ten or hundred? 97 118 and 5 179 5,091
  80. medical billing and coding

    choose a product you bought within the last month from a clothing or shoe store, describe how the four factors contributed to the elasticity of the good, is the product elastic, unitary or inelastic, in a few sentences what effect does the current supply
  81. english grammar

    Are the qutation marks correctin either number one or two? 1.“Did the professor say,” Put down your pencils?”’ Janice asked. 2. "Did the professor say, 'Put down your pencils?’ Janice asked
  82. math

    Write the number of permutations in factorial form. Then simplify. J K L M N O P 7! 720 8! 40,320 7! 49 7! 5,040 I think it is d.
  83. math

    Turn 7 21 into a percent and decimal. First simplify the fraction. Show your answer on the number line.
  84. algebra

    Are the following true or false? 1. The difference of two natural numbers is always a natural number. 2. The sum of two natural numbers is always a natural number. 3. The quotient of two natural numbers is always a natural number. 4. The difference of two
  85. physics

    Four charges with equal magnitudes of 6.50 x 10-15 C are placed at the corners of a rectangle. The lengths of the sides of the rectangles are 4.07 cm and 5.28 cm. Find the magnitude of the electric field at the center of the rectangle, assuming that three
  86. Math

    Solve the following quadratic equation(as exact values) using the quadratic formula. x^2-10x-15=0 I got 5+-2sqrt10/2. ^ Sorry hard to write it out. But basically there is a 5 there, the negative sign is supposed to be under the positive sign, then there is
  87. Database Design (SQL)

    I need help creating a query that shows the number of days left before the end of the term. I need the following functions to accomplish this: CONCAT, DAYOFYEAR, NOW. So far I have this for my query: SELECT CONCAT('There are ',DAYOFYEAR(NOW()),'
  88. Math

    Which one of the following is an example of a repeating decimal? A. 0.6666666(W/ repeating sign) B. 1.234545 C. 0.123321 D. 6.787878(W/ repeating sign) I think its A but D is also repeating. If I'm wrong please elaborate
  89. Math

    Please check my work. 1) 64 divide -4 = -16 2) -144 divide (-9) = 16 3) Simplify -9 and a small 2 = -81 4) Simplify (-3) and a small 3 = -27 5) Add -4/11 + 5/11 = 1/11 6) subtract 5/11- [-3/11] = 8/11 7) multiply [-7/8] • [-2/4] = 7/16 8) divide -3.5
  90. biology

    I have another experiment that I am not clear about the results. Any help? Put water, hydrogen proxide, and manganese dioxide powder in test tube, see what happens. Then put sand in the mixture. Results? Then,put liver in it. What happens? Thanks for
  91. chemistry

    so I don't expect you to answer all of these I just don't understand how they work so if someone could just explain one or two so I can do the rest that would be helpful! Thanks! Use the activity series to predict whether the following reaction will occur.
  92. math

    how would this equation look: y=f(x+3) when y=f(x)= x^2 would it look like so.... x^2(x+3) adam, there's a slight problem with your notation in the expression y = f(x+3). Ordinarily we wouldn't put an expression in place of a variable, unless we were
  93. algebra

    I am supposed to write each logarithmic expression as a single logarithm. I have logbase3of13 + logbase3of3 and my answer is logbase3of39. Can I simplify that any further? also logbase3 of 3 is 1 1+ log3 13 is another answer, simpler, to me. oh, okay, so
  94. IB Algebra

    okay. so i don't know how to do the square root things. so this is going to be my square root sign: ^ Multiply:x ^7 ^14 ---x--- ^2 ^27 if you couls help i would be very greatful!
  95. Math generic rectangles

    Out of all problems this one I just don't know. I started it but I'm unsure .can someone help me please. Draw a generic rectangle to find each product. Then write a multiplication sentence with parenthesis for each one. 7 (1+11) So I am thinking the
  96. A&P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? 1A. What is its mRNA nucleotide sequence? AGCCCGAUGUUUUGUUUAGUUGCCCCGAGCGUUUGUUUAUUUGCC 1B. Indicate the product
  97. marketing

    I need a better understanding please. what is 2 external influences? Think of a product that you have seen advertised on television, a magazine, or on the radio. Describe the product and identify two external influences that might lead a person to purchase
  98. english

    Facetious remarks often communicate serious ideas. An example is this comment by Mark Twain: "One of the most striking differences between a cat and a lie is that a cat has only nine lives." What is the serious meaning behind that remark? What might be the
  99. Math

    leslie is in charge of packing snacks for her class. she has 30 cookies and 20 apples. she wants to put the same number of cookies and the same number of apples in each pack. what are the possible numbers of packs she can make? how many items are in each
  100. Math

    1. Which sentence will make the number sentence |-12| ? 12 true? A. = B.*equal sign w line through it* C. <*** D. > 2. How is the sentence "8 less than y is 2" written as an equation? A. 8-y=2*** B. Y=2-8 C. Y-8=2 D. Y+8=2 3. Which sentence will make