Genetics

407 results
  1. 7th G science

    What is/are the main factor(s) that determine(s) the height of a plant (genetics, environment, or both)? Explain your answer. I think that only genetics play a role but I am not sure.
  2. Criminal Justice

    Discuss the merits of the idea that genetics are a source for criminal behavior. Make sure to provide examples that can be found through research studies and have evidence linking genetics and crime, including twin studies, adoption studies, and
  3. Science

    Lesson 10:introduction to genetics unit test science 8A unit 2: introduction to genetics Connexus Wht are the awnsers any1:P 👍
  4. Psych

    CAN SOMEONE REVIEW MY ANSWERS AND TELL ME IF THIS IS CORRECT? Why is it flawed to ask how much of a particular behavior is due to genetics and how much is due to experience? It is inconsistent to think that behaviors are solely due to our genetic make-up.
  5. Genetics

    A homozygous pea plant with round peas and yellow cotyledons was crossed to a wrinkled, green plant. The F1 was selfed and produced: 193 round, yellow 69 round, green 64 wrinkled, yellow 26 wrinkled, green a) propose hypothesis that allows you to calculate
  6. genetics

    need help with these genetics problems. please help with what you can. thanks: Given that loci A and B in Drosophila are sex-linked and 20 map units apart, what phenotypic frequencies would you expect in male and female offspring resulting from the
  7. Bio- Genetics Quest.

    A freind of yours brings up the idea that, if a person's gene were all identified and sequenced, he would be able to tell everything about that person: what they look like, how they might act, even how they will progess in life, and how long they would
  8. biology

    Are an organism's characteristics determined only by its genes? Explain. Yes, an organism's characteristics are determined only by It's genes becuase the parents give their offspring genes which determines their characteristics. Is my answer correct? Do I
  9. Science, Genetics

    Please help me with science genetics questions? Thanks to all who answer. :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is
  10. Science

    What is Genetics?
  11. Please Help Me :( Science: Biology, Genetics!

    Please help me with science genetics questions? Thanks to all who answer!! :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is
  12. maths

    Relation b/w genetics and gp
  13. Genetics

    Whats a homolog?
  14. science (ASAP)

    what does the notation TT mean to genetics
  15. Biology

    How can the genetics of a human be studied?
  16. Science

    How are the structures in genetics related?
  17. Biology 101

    How are meiosis and genetics related?
  18. SCIENCE (GENETICS)

    if there are two forms of each of the seven traits, how many possible combinations are there?
  19. science

    why are karyotypes important tools for genetics?
  20. Genetics!!

    What is the function of a eukaryotic promoter sequence?
  21. science

    I am looking for my study guide - what ends translation ( genetics)
  22. Genetics

    what is the chance of a woman having five female children in a row?
  23. Genetics

    In general, what two methods are used to grow bacteria in the laboratory?
  24. genetics

    What would happen during DNA replication if there were no thymine nucleotides available?
  25. science

    What is a result of scientific research in the field of genetics
  26. Genetics

    Why is DNA replication termed semi conservative?
  27. 6th grade genetics

    transferring a gene from one organism to another
  28. Genetics

    Explain the chromosomal differences between males and females?
  29. genetics

    What kinds of amino acids on histone tails are able to be phosphorylated and why?
  30. Genetics

    Can chromosome instability cause an individual to be highly susceptible to cancer?
  31. biology

    how does the urinary system support reproduction and passing on genetics?
  32. Genetics

    Describe how chromosomes are cultured and prepared for laboratory analysis?
  33. biology - genetics

    is the cis-regulatory sequence found in the exome?
  34. genetics

    why are there not many clinical studies done on rare diseases such as Batten disease?
  35. Biology - genetics

    How does crossing over change the combination of alleles in gametes? Thanks :)
  36. Genetics

    Can you help me determine the phenotype and proportions expected from these crosses in chickens? a) RR Pp x rr Pp b) rr PP x Rr Pp c) Rr Pp x Rr pp
  37. Genetics

    The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA
  38. early childhood

    evolutionary psychology and behavior genetics: watson
  39. Genetics

    Describe how chromosomes are cultured and prepared for laboratory analysis?
  40. 7th grade science

    Why was Gregor Mendel given the title "The Father Of Genetics" ?
  41. human Genetics

    In a mouse cell at the start of mitosis, how many chromatids are present?
  42. Biology -Genetics

    True or False X and Y chromosomes are found only in eggs and sperm. T or F ?
  43. 7th grade science

    name two scientest who studied inherited genetics and what they used for research and why
  44. Biology - Genetics

    What would be the molar concentration of DNA in a normal human cell?
  45. Genetics

    Hi, Is it possible to have a recombination frequency greater than 50%? the answer would be yes as they would assort indepnedyt? correct? thanks
  46. Biology genetics

    In the summer squash, fruits may be white, yellow, or green. In one case, the cross of yellow X white produced an F1 of all white-fruited plants that, when selfed, gave an F2 segregating 12 white: 3 yellow: 1 green. (a) suggest gnotypes for the white,
  47. health

    what factor can influence obesity? A. genetics B. hormones C. environment D. all of the above my best answer is D is that correct
  48. quick science question

    What are some ways in which genetics collect samples to test for disorders?
  49. Genetics

    What is an approximate value of the length of a 30 nm fiber that contains 120,000 nucleotide pairs of DNA?
  50. Biology 101

    Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.
  51. Biology 101

    Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.
  52. BIO 101

    Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.
  53. genetics

    With PCR, one gene is all that is necessary to create a useful genetic fingerprint to discriminate between individuals. True False
  54. genetics

    Given the gene sequence ABCDE, crossing over should occur most frequently between_____. a. A-B b.) B-C c.) A-E d.) A-D e.) A-C PLEASE explain how you got the answer thanks!
  55. Biology - Genetics

    If genes a, b, c, and d are genetically linked to each other, does it follow that a recombination experiment would detect genetic linkage between a and d?
  56. psychology

    If you had to argue that either genetics (nature) or environment (nurture) has the greater impact on human development, which would you pick and why?
  57. bio

    Does anyone know a good website that covers aspects of human genetics? If so can i have the link and a summary of the site's content. thank you
  58. Genetics

    My bad! I put the wrong question! Here we go, the shortened one! ~~~~~~~~~~~~~~ How do nucleotides and hydrogen bonds affect the structure of DNA. ~~~~~~~~~~~~~~
  59. Genetics

    Question: Calculate the frequency of the AA, Aa, and aa genotypes after one generation if the initial population consists of 0.2 AA, 0.6 Aa, and 0.2 aa. What I have done is: P = (0.2)+(0.5)(0.6)= 0.50 q = 1-p = 1 - 0.50 = 0.50 Can someone check my answer
  60. Genetics

    which do you think was the more far-reaching accomplishment, determining the structure of dna, or sequencing the human genome? state a reason for your answer
  61. biology

    In reference to plant and animal adaptations, how are the principles of heredity and genetics applicable to how organisms change over time?
  62. bio : fundamentals of genetics

    A 3:1 ratio of tall to short plants in the F2 generation lends support to the principle of ________________.
  63. GBE (Genetics)

    What are the advatages of Eukaryotic genes splitting up? I'm not so sure how to approach the question, is it something to do with exons & introns or the nucleotide sequences?
  64. science

    Are there any websites that explain Mendelian genetics and show how to solve such problems in an easy, concise manner at an AP Bio level? Thank you
  65. biology

    studying genetics in mammals where can i find out about felines and canines that are proven mainly allergen free, thought not genetically modified?
  66. genetics

    i have a diploid cell with 3 pairs of homologous chromosomes A1,A2,B1,B2,C1,C2 with no crossing over. will my daughter cells after mitosis just be [A1,B1,C1] and [A2,B2,C2] or will there be a mix between the 1's and 2's creating more varieties?
  67. law ans ethics in allied health

    the science of improving hededitary is known as a.genetics b.amniocentesis c.dna research d.eugenics my answer is a
  68. Genetics

    1) Do you know if the nucleotide sequence of a mutation tell you anything about its dominance or recessiveness? 2) Do you know the role that Ras play in the signal transduction pathway that makes it an oncogene?
  69. psychology

    humanistic therapy acknowledge unconscious forces and --- as a source of personal difficulties environment negative thoughts genetics psychosis please help
  70. intro to psychology

    Genetics and what we inherit from our biological parents play a significant role in our intelligence level. In fact, researchers have found that:
  71. School advice please

    What medical research field is in more demand? If I want to get a masters, what would you recommend me taking in undergrad between physiology, biochemistry, genetics, neuroscience or biotechnology?
  72. Genetics/Biology

    Recombination frequencies a. arise from completely random genetic exchange. b. are the same for all genes. c. decrease with distance. d. are the same for cis and trans heterozygotes.
  73. Genetics

    1. How is sex expressed at the chromosomal, gonadal, phenotypic, and gender identity levels? How do genes in the pseudoautosomal region of the Y chromosome differ from X-Y homologs?
  74. Biology!!

    The lifespan of plants varies depending on genetics and survival strategies. Discuss the adaptive value of annual, biennial, and perennial life spans.
  75. Biology

    A 50 year old male who is not overweight and has normal blood cholesterol levels suffers a heart attack. Propose a possible explanation i think the answer would be genetics...
  76. genetics

    Can anyone help me with Genetics? I have some problems and answers and need them explained to me. Here are some of the questions and answers: 1. Assume that a dihybrid cross is made in which the genes' loci are autosomal, independantly assorting, and
  77. Biology

    I need help finding a scientific journal on either one of these topics and talk about science environment technology and society, how this research contributed. -Genetics -Plants -Evolution -Diversity
  78. Child psychology

    Studies on the development of sexual orientation highlight the importance of A.genetics B. environment C. prenatal hormones D. multiple factors I said A the enviroment, Now thinking its D
  79. science (Genetics and Evolution)

    What contains DNA? Where is DNA found? What is the difference between phenotype and genotype?
  80. Biology

    What are the key characteristics of a model organism? Name atleast 3 different model organisms used in genetics.
  81. biology

    How does the circulatory system and the lymphatic system support reproduction and passing along genetics?
  82. genetics

    Once the _______ checkpoint is passed in the cell cycles, the cell is committed to division
  83. Genetics

    Name the term used to describe the phenomenon in which a bacteriophage genome incorporates its genome into the chromosome of the host.
  84. Genetics 160

    Using D for tall plants and d for dwarf plants, a 1:1 ratio is obtained in which of the following crosses? These are my choices: Dd X dd DD X dd DD X Dd DD X DD Dd X Dd
  85. genetics

    Wild type, or wt, refers to the genotype that is the typical genotype found in nature. True False
  86. bilogy(genetics

    given the following genotypes GgWwTt and GgWWtt. what is the probability of producing an offspring with the following genotype? How do i solve this problem?
  87. Genetics

    if a start codon changes into a stop codon, how would this effect transcription? please help.
  88. psychology

    THE ABILITY TO SOLVE ABSTRACT PROBLEMS SUCH AS THOSE FOUND IN ALGEBRA AND HIGHER MATHEMATIC IS INFLUENCED BY BOTH DEVELOPMENT AND A)GENETICS B)SOCIETAL FACTORS C)HEALTH D)COGNITIVE STYLE
  89. spychology

    how human behavior may be genetically inherited from remote ancestors. Her field of interest is A. chemical psychobiology. B. evolutionary psychology. C. clinical neuropsychology. D. behavioral genetics.
  90. Genetics/Di hybrid Cross

    Can someone show me how to set up this dihybrid cross? The genotypes of the two parents are RRLL' x RWL'L'. The " ' " meaning "prime."
  91. GENETICS ASAP

    How do the nucleotides affect the DNA? ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ This question had two parts but I already the the first part and half of the second, so could you help me with this last part? Thanks in advanced, Derpy Pegasus
  92. genetics

    ______________ means that neither gene in a gene pair (genotype) masks the other. As a result, the traits carried by the 2 genes appear to be blended.
  93. Genetics

    What is the difference between genetic inheritance and epigenetic inheritance?
  94. genetics

    Suppose that for an organism, 2N = 8. How many chromosomes do the organism's gametes contain? Would it be 8?
  95. child psychology

    The ability to solve abstact problems such as those found in algebra and higher mathematics is influenced by devdlopment and A. genetics B. societal factors C. health D. cognitive style
  96. genetics

    If a green eyes girl whose father is green eyeid marries a brown eye boy then what genotype the nxt generTION has
  97. genetics

    If a green eyes girl whose father is green eyeid marries a brown eye boy then what genotype the nxt generTION has
  98. psychology

    1.Identify a typical developmental milestone for a person at a specific stage and explain how achievement of this milestone might be impacted by genetics and environment.
  99. Genetics

    The genome of Elradicus hypotheticus consists of 3 x 105 bp of B-DNA. a. How many turns are present in the double-helix? b. What is the length of the DNA in μm?
  100. Genetics

    Given the following portion of a double stranded DNA molecule, 3’GATCTCGATGTCGAGATC5’ draw the bands as they would appear on a Sanger DNA sequencing gel using the following primer 5’GATCTCGA3’

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5