1. Economics HELP!!!

    I need some help because its due tomorrow. And these are the questions: 3. According to economists, almost everything we do, has costs and benefits. Identify the costs and benefits of each of the following: going to the dentist for a checkup, doing your

    asked by Jaden on January 13, 2016
  2. ECONOMICS HELP!!!

    I need some help because its due tomorrow. And these are the questions: 3. According to economists, almost everything we do, has costs and benefits. Identify the costs and benefits of each of the following: going to the dentist for a checkup, doing your

    asked by Jaden on January 14, 2016
  3. UOP

    Assuming Alexa receives $20,000 in gross rental receipts, answer the following questions: a. What effect does the rental activity have on her AGI for the year? b. Assuming that Alexa’s AGI from other sources is $90,000, what effect does the rental

    asked by DEANNA on December 27, 2010
  4. accounting

    Assuming Alexa receives $20,000 in gross rental receipts, answer the following questions: a. What effect does the rental activity have on her AGI for the year? b. Assuming that Alexa’s AGI from other sources is $90,000, what effect does the rental

    asked by Ramona on May 6, 2010
  5. english.

    “[R]emembering the rhythm” and “backs of buses” both contain examples of (1 point) alliteration. stanzas. rhyme. onomatopoeia. 2. Choose the option that corrects the sentence below. If the sentence is correct, select “d. The sentence is correct."

    asked by bella on April 28, 2013
  6. physics

    Laser light is commonly used to demonstrate double-slit interference. Explain why laser light is preferable to light from other sources for observing interference. Doesn't double slit interference work best on monochromatic light? yea

    asked by anonymous on April 27, 2007
  7. Pre-Calculus

    Exponential Functions This is my equation that models the accumulated amount (A) at any time t. A = 1000(1+0.08/12)^t*12 ^ How do I plot that into the graphing texas instruments calculator? What I do I type in the y-axis?

    asked by Shreya on October 8, 2012
  8. social studies

    how did the war with mexico lead to conflict between the north and the south? Texas was pro-slavery. http://www.pinzler.com/ushistory/timeline5.html

    asked by caleigh on March 27, 2007
  9. Texas State History

    At the end of the Spanish rule, which group had the largest population in Texas? A) Peninsulares B) Catholic clergy C) Anglo Americans D) American Indians *** (my answer)

    asked by ILTHSM_ on September 19, 2018
  10. U.S. Presidents

    Are former presidents of the United States who are still alive today have retired from politics? I think it's obvious that it's true, but George W. Bush is still the owner of the MLB's Texas Rangers.

    asked by AL 92 on November 14, 2010
  11. Texas history

    What was a benifit for texas? Select all that apply A)clear borders established B)improved relations with mexico C)loss of previous debts*** D)u.s. Military support***

    asked by Anonomus on November 7, 2017
  12. History

    At the time of early european exploration in the sixteenth century what area of texas did the coahuiltecans. A.Eastern B.Northern C.Sothern D.Western I think the answer is B I need help asap please

    asked by PICKLE on September 12, 2018
  13. History

    What did Texas annexation promise to its people? A. cultural similarities B. need for new farmlands C. opposition to slavery D. worries of American Indian influence for this I can choose 2 answers

    asked by Wednesday_my_dudes on November 18, 2018
  14. Texas History

    Which group most benefited from new settlement in South Texas in the 1840s and 1850s? a) Anglos b) Tejano Patrons c) Enslaved African Americans d) German Immigrants

    asked by FoodIsGreat on November 29, 2018
  15. economics

    How do an economist as a scientist and an economist as a policy advisor help to create understanding of economics? As a scientists, we conduct experiments and do research following the scientific method. (e.g., we observe a phenomena, form a hypothesis,

    asked by tracey on May 15, 2007
  16. U.S.History

    please check: 1. How did the Jacksonian Democrats differ from the National Republicans? A. They opposed government interference with the economy. b. They thought the federal government should control business. c. They supported a high tariff on foreign

    asked by y912f on February 4, 2009
  17. Science

    I need help on this letter. You do not have to give me full answers but if you do give me a full answer, I will use it but edit it into my own words. Now it is time to apply and share what you have learned so far about energy sources. After completing the

    asked by Chiki on May 19, 2017
  18. Social Studies

    1. Which of these South Asian countries is an Islamic republic? A. Pakistan B. Bangladesh C. Sri Lanka D. Nepal I believe the answer is A but I want to make sure 2. Why are poverty levels high in much of South Asia? A. high populations and low economic

    asked by alexa on September 26, 2018
  19. Economics

    What is the relationship between the level of Gross Domestic Product and economic well-being. What factors of well-being are missing from the Gross Domestic Product? Is there a point where the Gross Domestic Product could increase to such a high level that

    asked by Anna on September 15, 2008
  20. social studies

    what were the similarities and differences between the five regions of British colonial America and what factors worked to create a shared American identity by the mid 18th century

    asked by C on August 27, 2009
  21. History

    what were the similarities and differences between the five regions of British colonial America and what factors worked to create a shared American identity by the mid 18th century ?

    asked by C on August 27, 2009
  22. science

    Oserving hillslopes, stream patterns, and bedrock structures would help identify 1 magnetic north 2 earthquake epicenters 3 fossils 4 landscape regions is the answer: 4.

    asked by Anonymous on February 16, 2009
  23. Calculus

    Find the number b such that the line y = b divides the region bounded by the curves y = 4x2 and y = 1 into two regions with equal area. (Round your answer to two decimal places.)

    asked by Graham on November 18, 2013
  24. math

    Find the first and second derivative of the function y=f(x)=x^3/(1-(x^2)) Use the information about the derivatives to determine any local maxima and minima, regions where the curve iss concave up or down, and any inflection points

    asked by ravinder on November 22, 2012
  25. calculus

    Find the number b such that the line y = b divides the region bounded by the curves y = 16x2 and y = 9 into two regions with equal area. (Round your answer to two decimal places.)

    asked by Courtney on November 9, 2011
  26. calculus

    Find the number b such that the line y = b divides the region bounded by the curves y = 16x2 and y = 9 into two regions with equal area. (Round your answer to two decimal places.)

    asked by Courtney on November 9, 2011
  27. us hist

    You have many skills, a broad variety of work experiences and a college degree. Do you favor the Pendleton Act? Only in the eastern industrial regions Only in the southern states Yes No I know its not no. is it yes or..

    asked by jay on May 15, 2014
  28. Calc 1

    A rectangular garden is to be enclosed by a fence and divided into 5 regions as shown below. Find the values of L and W for which the total area is as large as possible assuming that only 120 ft. of fencing is available.

    asked by TayB on May 3, 2015
  29. Calc

    Find the number b such that the line y = b divides the region bounded by the curves y = 4x2 and y = 16 into two regions with equal area. (Round your answer to two decimal places.)

    asked by James on May 27, 2016
  30. Life orientation

    A)In 10-15 lines critically discuss 5 ways in which the enviromental problems impacts the community.Provide relevent sources to support your claims. b)Provide recommendations on how to address the topic that you identified in the previous question. c)Name

    asked by Sello on May 2, 2011
  31. Courts

    Write a 1,100- to 1,400-word paper in APA format comparing the entertainment fiction of the court system with its reality. · Select examples from fictional portrayals of the courtroom found in books, movies, or television; for example, The Runaway Jury, A

    asked by Katie on April 27, 2010
  32. economics

    The table shows the relationship for a hypothetical firm between its advertising expenditures and the quantity of its out-put that it expects it can sell at a fixed price of $5 per unit. Advertising Quantity Sold at P = $5/IN Expenditures (millions)

    asked by Anonymous on December 4, 2009
  33. HCA 210 Introduction to Health Care

    What is the definition of mental illness? Can mental illness be as clearly defined as a physical illness such as diabetes? Can mental illness be cured? o Has the concept of deinstitutionalization been effective in providing needed services to the mentally

    asked by Nicole on August 10, 2009
  34. HCA 210 Introduction to Health Care

    What is the definition of mental illness? Can mental illness be as clearly defined as a physical illness such as diabetes? Can mental illness be cured? o Has the concept of deinstitutionalization been effective in providing needed services to the mentally

    asked by Anonymous on April 23, 2009
  35. Sociology

    Identify, specifically, the ethical issue and the ethical problems it presents. Drawing on various sources, explain how one of the classical theories (utilitarianism, deontology, virtue ethics) would resolve the problem. Then, contrast this response with

    asked by Marie on October 8, 2012
  36. Accounting

    Please help (Revenue Classification) Clark County had the following revenue sources in 2011: General property taxes $8,000,000 Restricted (for education) property taxes 570,000 Meals tax (restricted for economic development and tourism) 200,000 Fines and

    asked by Patte on May 16, 2016
  37. hitory game questions plz help

    1.What did the spanish do in response to la salle's activities? A)gave up their claims in texas B)shifted their focus to east texas C)attacked the french settlers**** D)tried to sign a traety with the french 2.the spanish soldiers who sought welth and

    asked by awesomeguy123 on October 21, 2015
  38. science

    Can a cellphone place near a pacemaker patient heart change the pacemaker patient heart rate and how? Can I use my cell phone if I have a pacemaker? The types of cell phones used in the United States are less than 3 watts and do not seem to affect

    asked by nikki on December 27, 2006
  39. Texas History

    6.Why did Southerners support Texas statehood? select all that apply. (2 points) A. cultural similarities B. need for new farmlands C. opposition to slavery D. worries of American Indian influence

    asked by sparkles on December 9, 2018
  40. Texas history

    Which factor best explains the urbanization of Texas after world war II? A. Affordable urban housing B. decline of agribusiness C. More manufacturing jobs*** D. Rising rural crime

    asked by NekoBlueberrySans on April 2, 2018
  41. Math

    The president of Texas state University makes three times as much money as one of the department heads. If the total of their salaries is 290,000, find each worker's salary.

    asked by Selena on June 11, 2014
  42. social studies

    which of the following reasons was least important in Texas decision to secede A. support for slavery B. opposition to tariffs C.desire to form calvary units D. belief in states rights

    asked by I NEED HELP ASAP PLS on January 18, 2017
  43. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC

    asked by Jessica on November 30, 2014
  44. financial securities

    Cat Bonds An insurance company has sold insurance to cover damage that arises from hurricanes in the South Texas area. If a hurricane occurs, the insurance company is faced with losses as it pays out claims. The magnitude of the losses will depend on many

    asked by sam on March 29, 2017
  45. Underline the topic sentence in the paragraph.

    Paragraph one is an analysis because the writer breaks down the points of piece of writing and considers how they relate to each other. Paragraph two is a summary because a summary is a description of the essence of the topic and this paragraph does

    asked by maribel on September 27, 2010
  46. history

    1. What was the Alamo before it was a fort? What was its original name? 2. Who led the Mexican Army during the battle of the Alamo? He is the villan of the Texas revolution. 3. How many Mexican soldiers attacked the Alamo? How many Texans defended the

    asked by lindacampoalegre2 on May 31, 2017
  47. Government

    Do you think that governors should have significant powers? I know there are about 14 states, Texas being one that their governor has very little power. But why should these governors be allowed more?

    asked by Joe on February 26, 2011
  48. math

    the sales tax rate in fortworth, texas is 8.25%. find the tax charged on a purchased of $26.98

    asked by ariyah on February 24, 2013
  49. Texas history PLEASE HELP

    Which if the following people would probably have agreed with Travis’s ideas in “To the People if Texas and All Americans in the World”

    asked by Pug lover on October 30, 2018
  50. Q&A Check Please, geo 7th grade

    Many of the mineral deposits and oil reserves in Nunavut, the Yukon, and the Northwest Territories have not been developed because a. environmental laws prohibit the mining of land in these territories. b. native Inuit refuse to give up their lands. c. the

    asked by rawr... im a dinosaur.... rawr on November 4, 2012
  51. Discussion Board

    1. Using chapter 13 of your text and Cybrary resources, which personality theory do you think offers the best explanation for how an individual's personality develops? Why? Defend your answer including citations of the appropriate literature on personality

    asked by candy on September 21, 2006
  52. health

    Mary was receiving Medicaid in Texas. When she moves to California, can Mary assume that she’ll receive the same coverage there?

    asked by Anonymous on January 6, 2010
  53. Reimbursement Methodologies

    Mary was recieving Medicaid in Texas. When she moves to California can Mary assume that she will receive the same coverage there ?

    asked by Maryana on November 21, 2010
  54. Texas Government

    When you vote in Texas, you are voting by a. county. b. precinct. c. caucus. d. state. e. municipality. I would say county? Correct?

    asked by HM on December 4, 2011
  55. Statistics

    In the case of Castaneda vs Partida, it was noted that although 80% of the population in a Texas county was Mexican-American, only 39% of those summoned for grand juries were Mexican-American. Assume that 12 jurors are to be summoned from a population that

    asked by tamar on November 17, 2017
  56. Biochemistry

    explain why a strong acid or base can denature an enzyme explain how varying pH influenced the rate of the catalase reactions and explain why. explain the influence of temperature in excess of 50 degrees C on the influence of most enzyme controlled

    asked by Zac on October 28, 2009
  57. educational research

    I so overwhelm and lost at the moment. Summarize and complete an annotated bibliography of at least ten (10) scholarly sources that pertain to your research topic. This annotated bibliography should be a minimum of five pages in length, excluding title and

    asked by June on October 1, 2012
  58. Civics

    Would it be possible to have a social direct democracy? -No, in a socialist society only a few high-ranking member of the communist party have political power. -No, a direct democracy requires a free market economy which is not socialist. -Yes, if everyone

    asked by Anonymous on June 10, 2014
  59. Managerial econ 1

    1)The Midnight hour, a local nightclub, earned $100,000 in accounting profit last year. This year the owner, who had invested $ 1 million in the club, decided to close the club. What can you say about economic profit (and the rate of return)in the

    asked by Ed on July 24, 2007
  60. Microeconomics

    A major overhaul of the Federal Tax structure was enacted at the end of 2017, effective beginning with the 2018 tax year. This assignment consists of a calculation to gauge effects on your own situation or upon a mythical one, as well as some analysis of

    asked by Yasmin on April 16, 2018
  61. Calculus

    Find the number a such that the line x = a divides the region bounded by the curves x = y^2 − 1 and the y-axis into 2 regions with equal area. Give your answer correct to 3 decimal places.

    asked by John on January 22, 2016
  62. US History

    Although the New England, and the Chesapeake region were both settled largely by people of english orgin, by 1700 the regions had evolved into 2 distinct societies. Why did this difference in development occur?

    asked by Ashley on October 5, 2014
  63. calc

    Find the number a such that the line x = a divides the region bounded by the curves x = y^2 − 1 and the y-axis into 2 regions with equal area. Give your answer correct to 3 decimal places.

    asked by Anonymous on June 13, 2015
  64. check

    european populations tend to be clustered: A)in regions with fertile farmland and inland waterways B)in the mountains C)near mineral mines D)near the region northern forests my choice is a

    asked by henry on August 24, 2009
  65. English

    20. Which of the following is not an objective of synthesizing sources? A. Combining opinions and general statements B. Exploring different points of view C. Reviewing key ideas on a topic D. Understanding the topic in depth 19. Which type of Internet

    asked by Ariel on February 9, 2018
  66. Gen 200

    Prepare a 700 to 1,050-word paper in which you explain the relationship among professional values, ethics, and career success. Address the following items in your explanation: Define values and ethics. Identify at least three sources of professional values

    asked by Alida on March 15, 2010
  67. Gen 200

    Prepare a 700 to 1,050-word paper in which you explain the relationship among professional values, ethics, and career success. Address the following items in your explanation: Define values and ethics. Identify at least three sources of professional values

    asked by Alida on March 14, 2010
  68. Sociology

    Which of the following is an example ofprejudice?John, who lives in Texas, believes that the US is the best country in the world, or Mary believes that all men are pigs?

    asked by Shirley on December 1, 2010
  69. STAAR

    So this isn't about anything really, but, what is STAAR like for online school? Thanks in advance. (STAAR = State of Texas Assessment of Academic Readiness)

    asked by ER98 on January 29, 2019
  70. history

    Which of the following state has the least amount of net farm income Answer Are Texas New Jersey Louisiana California I think New Jersey Thank You

    asked by snow on April 29, 2014
  71. ENGLISH

    I am having a hard time finding something on our president and the Texas Assessment of Knowledge and Skills can anyone help me. Do you know if he has ever said anything about the test or if the test will be stopped.

    asked by RT on September 21, 2010
  72. law

    what does it mean when Steven said The case has nothing to do with 'disagreeable ideas' in the Texas v Johnson case?

    asked by Bob on June 9, 2013
  73. Geography

    What is the economy and most popular job opportunity in Northeast Regions? (New England, all 12 northeast states)

    asked by Lily on November 4, 2008
  74. geography

    Canada's political regions went through a major change in 1999. what was this change? what new boundaries were created?

    asked by raluca on February 25, 2010
  75. Criminal law

    i'm needing help under standing the assignment please help. Describe the purposes of criminal law.Describe the two main functions of criminal law.Describe the written sources of American criminal law and their purposes.Describe how criminal responsibility

    asked by Tina on September 6, 2008
  76. social studies

    Forecasts of economists have.....1. overestimated inflation 2. underestimated inflation 3. generally been accurate on inflation 4. been less accurate than forecasts of economic growth 5. been as accurate as those for economic growth

    asked by carrie on October 27, 2011
  77. World cultures

    What are the five main regions of Africa? I looked it up but, all of them say south, north, central, west, and east Africa

    asked by Valeria on February 21, 2011
  78. statistics

    A spinner has equal regions numbered 1 through 21. What is the probability that the spinner will stop on an even number or a multiple of 3? (Points : 5)

    asked by Anonymous on December 4, 2011
  79. Geography

    What is similar and different about the South Asian regions? Similar : A lot of them splintered from each other Different : Founders were completely different Is this good

    asked by Anonymous on February 9, 2016
  80. mechanics

    Sketch a stress-strain curve for glass and label all the points of interest and different regions of the curve.

    asked by dmkp on February 24, 2013
  81. mechanics

    Sketch a typical stress-strain curve and label all the points of interest and different regions of the curve.

    asked by dmkp on February 24, 2013
  82. calc

    Each of the regions A, B, and C bounded by f(x) and the x-axis has area 5. Find the value of ∫2 [f(x)+3x^2+2]dx. −4 I know to solve I can find the antiderivative of the equation but im not sure how to do this because of the f(x) in the parentheses.

    asked by DD on November 16, 2014
  83. History

    What was the benefit of Annexation for Texas select all that apply. (2 points) A. Clear borders establish *** B. Improved relations with Mexico C. Lots of previous debt D. U.S. military support ***

    asked by Anonymous on December 4, 2018
  84. history

    hi can someone help me with this question 1. President Van Buren is best remembered for a. causing a panic b. establishing the independent treasury system c. ending the bank of the united states d. annexing texas I think it is A but can't it also be B

    asked by phil on November 9, 2008
  85. History

    What information would you need to create an absolute chronology of the Texas revolution A. Key revolutionary figures B. Locations of significant events.... C. Relationships to other eras. D. Specific dates of battles

    asked by I need help on August 29, 2018
  86. Geography

    how did the decade of prosperity affect the lives of many Mexican-Americans in Texas They became wealthier They became migrant laborers They Moved to other states They Entered New Industries My answer is the 3rd one please check that for me!

    asked by Ray on January 31, 2018
  87. social studies

    Thank you for every single question I've asked you. You're a great teacher Ms.Sue. I learned a lot from you. May god bless you.But, before I go I want to make sure my answers are right for this qustion. Here they go, Louisiana, Texas, Alabama, and

    asked by shaun on August 29, 2010
  88. Texas History

    ____________________ contributed to the growth and prosperity of Texas, and helped make the United States a leading oil producer in the world. A.Agriculture B.Explorers (C).Spindletop D.Climate

    asked by SuperbronyPokefanDigibroNintenerdweeabooOCmakerAnimaniacwithahotbodFromthefuture on October 4, 2018
  89. Heath Care Introduction

    # What is the definition of mental illness? Can mental illness be as clearly defined as a physical illness such as diabetes? Can mental illness be cured? # Has the concept of deinstitutionalization been effective in providing needed services to the

    asked by anonymous on August 10, 2009
  90. math

    Describe a simple process for using rates and unit prices that might help someone who is having difficulty understanding these concepts. Include either an example from the text or one of your own to explain the solution process. I searched Google under the

    asked by ashley-help please! on August 1, 2007
  91. Justice Studies

    Hello, I need help in locating format for filing a Discovery Motion in the State of Texas. I have searched but can't find anything on formatting for filing. Devon

    asked by Devon on May 7, 2015
  92. world studies

    Who was responsible for planning the settlement of Texas A. Stephan F Austin B. Moses Austin C. Erasmo Seguin D. Martin DeLeon

    asked by hola how are you on October 2, 2018
  93. ethnics

    The Official Language Movement · Resources: Racial and Ethnic Groups, the Internet, and the University Library · Investigate the Official Language Movement, which is an important Hispanic American cultural interest, described on pp. 243–244 of the

    asked by Anonymous on May 6, 2010
  94. Calculus

    Let R be the region bounded by y = 1/x, the lime x = 1, the line x = 3 and the x-axis. The line x = k divides R into two regions of equal area. Determine k.

    asked by Liz on June 14, 2011
  95. us history

    different labor systems predominated in various regions of british americ. how did the economy of each region help determine its labor system?

    asked by Anonymous on September 15, 2010
  96. Social Studies

    I need to find what the caribbean regions natural resources are, but I can't figure it out. I tried Google and Ask, but I couldn't find any helpful websites.

    asked by Christina Gabriella on February 6, 2008
  97. calc

    Sketch the regions represented by the following integrals and evaluate them using geometric formulas. 4 integral 1: 2x+3dx 6 integral -2: lx-1l dx (absolute value of x-1

    asked by Leila on November 9, 2016
  98. history

    Different labor systems predominated in various regions of British America. How did the economy of each region help determine its labor system?

    asked by Pierre on August 25, 2010
  99. science

    What is a timberline? Timberline: On mountains and in frigid regions, the line above which there is no timber.

    asked by Brittany on October 22, 2006
  100. Calc

    Find the value of m such that y=mx divides the area under the curve y=(1-x)x in [0,1] into two regions of equal area D: D: D:

    asked by James on August 17, 2016