science, biology

40,893 results, page 67

  1. Biology

    I have a research article about the early advancement of laying times for Flycatchers, a bird species through Europe and Asia. My variables are: - Annual temperature recordings in each study site - The species, flycatcher - Clutch size of the flycatchers - The location of each...
  2. Biology

    In regards to color-blindness, I have a question! (Please make sure to note how the trait is passed on first.) If a woman is affected by colorblindness are both of her parents carriers or just one? What if a man is affected - do both of his parents have to be carriers for the ...
  3. science

    Describe the process by which a fungus feeds. A fungus feeds first by growing hyphae into the food source. Then chemicals ooze from the hyphae into the food source. The chemicals break down food into substances that the hyphae are able to absorb. I used our science book. Our ...
  4. Biology

    Darwin was able to formulate his theory of evolution based on several facts. Which of the following facts was unavailable to Darwin in the mid-nineteenth century? Natural resources are limited. Individual organisms in a population are not alike. Characteristics are inherited ...
  5. Biology (genetics)

    The RAS protein acquires a mutation that prevents release of GTP. Which of the following characteristics are these cells likely to acquire? a)Self-sufficiency in growth signals b) insensitivity to anti growth signals c) angiogenesis d) metastasis e) blocking apoptosis I ...
  6. Science (please help me)

    I have 2 question on science 7. please help me. 1.state whether each substance is a mechanical mixture, a suspension, or a solution. My answers are at the bottom. a)green relish b)soda pop in a glass c)bubble tea d)traditional Aborigial paint made of red orchre and grease my ...
  7. Biology

    The shrunken gene of wheat encodes a large enzyme that converts glucose to starch in its grains. How would insertion of a 1 kb transposon into codon 23 of this gene affect the protein produced from this allele? A. The protein would be longer and still functional. B. The ...
  8. physical science

    Please check my answers on this physical science quiz, thanks 1. in which of the following scenarios are action and reaction forces involved? a. when a tennis racket hits a ball b. when you step from a curb c. when you row a boat d. all of the above** 2. the product of an ...
  9. Biology

    a genetisict studying coat color in animals crosses a male bunnicula having the genotype CC with a female having genotype Ccand the little subscript letters ch. The geneticist then crosses a cc(small letters ch) male with a Cc(small letter c) female. make a punnet square for ...
  10. Biology

    What happens when a substance dissolves in the watery solution outside of a cell and equilibrium is disrupted. a. Water from the cell will move into the solution b. water from the solution will move into the cell c. the pores in the cell membrane will become clogged with the ...
  11. biology

    polar molecule are soluble in water. how does this activity demonstrate polarity of molecule that contain the -OH group. our activity was to do an experiment mixing 2 diff liquids together to see if they dissolve and tell if its polar or nonpolar. 1. water and oil= polar 2. ...
  12. Biology

    When errors in nucleotide sequencing occur,? a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide. b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one. c. purines replace pyrimidines in the DNA molecule. d. DNA ...
  13. human biology

    I need some information on the nephron and H+ ions. My book just has it in a diagram, but the diagram talks mostly about the K+ ion relationship. Can someone just give the gist of the H+ relationship with the nephron? thanks Since this is not my area of expertise, I searched ...
  14. Biology and Graphing (Stats)

    i need to make a graph on excel.. my data involve putting goldfish (from the same tank and same type) into 3 different environments : acidic, neutral (control), and basic. What kind of graph should I use? just a line graph? but then what should my variables look like? the 3 ...
  15. Biology

    After a strain of bacterial cells is exposed to a chemical mutagen, only 30% of the cells produce new colonies that continue to grow. Which of the following can be concluded? A. Some cells underwent advantageous mutations. B. Some cells underwent neutral mutations. C. Some ...
  16. Biology

    How do the kidneys clean the blood? (1 point) • Kidneys clean the blood by breaking down nutrients. • Kidneys clean the blood by filtering it to remove wastes. • Kidneys clean the blood by absorbing nutrients. • Kidneys clean the blood by destroying microbes and ...
  17. science

    49. A researcher writes a grant proposal to repeat an experiment that was recently published by another researcher. Which of the following statements best supports the grant proposal? A. Funding this grant proposal will allow this laboratory to continue to study this topic. B...
  18. Biology

    1. Meiosis occurs during the production of gametes_______ within the sex organs. It is a type of division that reduces the chromosome number from the _____ number to the _______ number. 2.The _______pairs of chromosomes are called________. During meiosis the homologus ...
  19. Biology

    In order to predict the percentage of males and females three assumptions must be considered: 1. The X carrying sperm and Y carrying sperm have an equal chance of fetilization: 2. The egg and sperm combine at random: 3. the XX and XY zygotes have equal chance of development at...
  20. biology

    Below the human hemoglobin sequence are the first thirty amino acid sequences of several other species’ hemoglobins. Inspect the sequences and answer the following questions: Human) h l t p e e k s a v t a l w g k v n v d e v g g e a l g r l A) ml t a e e k a a v t a f w g k...
  21. Biology

    What is the targeting pathway from translation until the protein reaches it's final functional destination for PFK and insulin? Choose from the following choices for each: a) golgi -> ER -> outside of cell b) ER -> golgi -> cytoplasm c) cytoplasm only d) nucleus -&...
  22. literature (bejamin Franklin)

    I have one more confusing question regarding this. And Thank you Ms.Sue for answering the last question! Franklin's humor in Witch Trial at Mt. Holly depends upon the belief that... a)the belief that religion takes precedence over science b)the belief that the physical laws of...
  23. Biology

    Technology is equipment used to do something or make something. Biochemical technology or biotechnology refers to the use of living organisms for the formation of products useable by humans. Recombinant DNA technology is one type of biotechnology. List the steps involved in ...
  24. Biology (Answer Check)

    State how comparing the amino acid sequence of a protein can provide evident that evolution has taken place. A: If evolution has taken place, then, in general, species descended from a recent common ancestor should have fewer amino acid differences between their proteins than ...
  25. Biology

    All cell are surrounded by membranes. The main role of the cell membrane is to A.regulate the cell's interactions with the environment b.release any type of molecule out of the cell c.arrange the cell's organelles in the cytoplasm d.prevent water from leaking out of the cell ...
  26. Biology

    All cell are surrounded by membranes. The main role of the cell membrane is to A.regulate the cell's interactions with the environment b.release any type of molecule out of the cell c.arrange the cell's organelles in the cytoplasm d.prevent water from leaking out of the cell ...
  27. Biology

    In most Hymenoptera, all fertilized eggs develop into diploid females and all unfertilized eggs into haploid males-a condition known as haplodiploidy. Workers in these colonies share half the alleles they received from their mother, but share all of the alleles they received ...
  28. Biology

    Conducting cells in xylem are: Sieve tube elements Tracheids Tracheids and vessel elements Vessel elements Tracheids and sieve tube elements please help with my homework thanks.
  29. Biology

    A farmer planted a field of Bt 123 corn and wants to estimate the yield in terms of bushels per acre. He counts 22 ears in 1/1000 of an acre. He determines that each ear has about 700 kernels on average. He also knows that a bushel contains about 90 000 kernels on average. ...
  30. biology

    6. A farmer planted a field of Bt 123 corn and wants to estimate the yield in terms of bushels per acre. He counts 22 ears in 1/1000 of an acre. He determines that each ear has about 700 kernels on average. He also knows that a bushel contains about 90 000 kernels on average. ...
  31. Biology - please help

    After a strain of bacterial cells is exposed to a chemical mutagen, only 30% of the cells produce new colonies that continue to grow. Which of the following can be concluded? A. Some cells underwent advantageous mutations. B. Some cells underwent neutral mutations. C. Some ...
  32. Biology

    Father has red/green color blindness and is a hemophiliac. Mother is normal. Have two female children (Both are probably carriers). One female offspring marries a normal male. The question is what is the probability that their son is both color blind and hemophiliac? ...
  33. Biology

    J.J. Thomson's experiments supported the existence of a particle that deflected away from a negative charge and toward a positive charge. Ernest Rutherford found that when positive particles were fired at gold foil, some of the particles deflected rather than passing straight ...
  34. Biology - Please check?

    How does artificial selection differ from natural selection? (Free response) Here is what I wrote: While both of these selections have to do with breeding, artificial selection (same as selective breeding) is where either plants or animals are intentionally bred for scientific...
  35. Biology

    Pollen transport in flowers Pollination is the transfer of pollen containing male sex cells from the stamens of a plant to the pistil containing the eggs. Afterward a pollen tube grows through the pistil and sperm nuclei migrate to the egg where fertilization (union) takes ...
  36. science

    list as many ways as u can how are crystalline solids connected to science? how are crystalline solids connected to math? how are crystalline solids connected to the world? how are crystalline solids connected to you? why is it important?
  37. math lit, geography, life science,business studies

    hey there! what career can do with math lit, geography, life science and business studies?
  38. Biology

    Which phrase does NOT describe one of the functions of proteins of the plasma membrane? -forming a channel through the membrane -initiating the replication of the genetic material (CORRECT) -binding to a substance to carry it through the membrane -acting as a pump to move ions...
  39. biology / CELEISTINE

    describe the genetics of the huntigton disease a. what chromosomes are affected? b. is it a result on translocation/ c. is it a sex-linked? d. does it skip a generation 3. waht are the cause of huntington disaese? how does it occur ? is it preventable ? how ? 4. waht are the ...
  40. bio

    given: 6 fingers is an x-linked trait and is recessive (5 fingers being dominant question: if you have a father with 6 fingers and a mother that has 5 fingers, but carries the 6 finger trait, what is the chance that they will have a child with 6 fingers? You can do this on a ...
  41. Public High School AP Biology

    I got a question that comes from the 1990 released test #61 that I'm completley lost on 61. In a population that is in Hardy-Weinberg equilibrium, the frequency of a recessive allele for a certain hereditary trait is 0.20. What percentage of the individuals in the next ...
  42. Public High School AP Biology

    I got a question that comes from the 1990 released test #61 that I'm completley lost on 61. In a population that is in Hardy-Weinberg equilibrium, the frequency of a recessive allele for a certain hereditary trait is 0.20. What percentage of the individuals in the next ...
  43. cp biology

    include the following vocabulary when completing the concept map. be sure to PLACE THE WORDS in the correct step of the scientific method, and DISCUSS what occurs at each step. words: qualitative data quantitative data independent variable data analysis/ interpretation law ...
  44. Biology

    Danielle was born with a birth defect which resulted in a lack of primary auditory cortex formation. Which of the following will likely result? a. Danielle will not be about to hear from her right ear. b. Danielle will not be able to hear at all. c. Danielle will need to get ...
  45. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5: GCCAAGGCACTACGCTACGTCGCATTATAC ...
  46. Biology:renal clearance

    i want to calculate the renal clearance of creatinine. rate of urine production=0.8ml min-1 creatinine concentration in urine is 15.7 mg ml-1 Thank you for using the Jiskha Homework Help Forum. A good site for kidney problems is DaVita: http://www.davita.com/
  47. biology

    Make a single base pair substitution mutation in the gene below that results in a protein that is shorter than the protein produce by the original gene. When you are satisfied with your change and its effect, click the "Final Check" button. Note that a "single base pair ...
  48. ENGLISH

    In which of the following sentences is the semicolon used correctly? A. There were five items on the kitchen counter; a coffeemaker, a bag of beans, agrinder, a sugar bowl, and a cracked cup. B. At first Icouldn't make out what kind of bird it was,but as I swooped low, I ...
  49. Biology

    When dental work is to be done, the gums and nerves in the teeth are anethetized by injection of lidocaine. This drug blocks Na+ channels in the membrane of the sensory cells. This drug is an effective local anesthetic because the A. Sensory cell membrane do not repolarize ...
  50. BIOLOGY

    Life cycle of a human being? http://www.nationmaster.com/encyclopedia/Human#Life_cycle
  51. English

    I forgot to add these few more things. They are really urgent. Thank you. 1) I told my collegues about the possibility of carrying out a Comenius project on how to write the screenplay and shoot (make) a film. 2) As a matter of fact, they would rather be involved in a project ...
  52. Biology

    In a lab on lung capacity where lung volumes (Tidal Volume, Expiratory Reserve Volume, Inspiratory Capacity, Inspiratory Reserve Volume, and Vital Capacity) are measured... Why can't you measure the Inspiratory Reserve Volume (IRV) directly? (In the procedure it says to do IRV...
  53. Biology

    In a lab on lung capacity where lung volumes (Tidal Volume, Expiratory Reserve Volume, Inspiratory Capacity, Inspiratory Reserve Volume, and Vital Capacity) are measured... Why can't you measure the Inspiratory Reserve Volume (IRV) directly? (In the procedure it says to do IRV...
  54. biology

    A true breeding brown mouse is mated with a true-breeding white mouse and all their offspring are brown. If two of these brown offspring are mated, what percentage of the F1 and F2 generations will be brown?
  55. mathematics

    in a class of 60 students, the number of students who passed biology is 6 more the number of student who passed chemistry. Every student passed at least 1 subject and 8 passed both subject. How many passed chemistry
  56. PHSICS

    1. How much kinetic energy does a 1 kg ball have if it has a velocity of 10 m/s? Choose one answer.and explain a. 100 J. b. 50 J. c. 10 J. d. 5 J. 2. You have the grand idea that the science building would be better situated if you moved it North by 4 meters. To accomplish ...
  57. Science

    Jordan is doing a science fair project on the effects of music and growth of tomatoes.he has two tomato plants, plant A and plant B that he grows in a window and gives the same amount of water. Plant A is exposed to classical music using headphones atttached to the soil. ...
  58. biology

    Predict the expected change to blood flow should norepi act on arteries of the abdominal cavity? A. Blood flow increases B. Blood flow decreases C. Blood flow stays the same but pressure increases D. Blood flow stays the same but speed decreases E. None of the Above
  59. Biology

    Which of the following statements correctly compares the functions of a plant's roots and stem? The stem contains a high percentage of cells that provide structural support, unlike the roots. The stem is the first part of the plant to emerge from a seed, followed by the roots...
  60. Biology

    Which of these organisms have cell walls? Which have chloroplasts? Describe their organization. Paramecium Amoeba Chilomonas Volvox Paranema I've tried searching on the web, but the pages don't mention chloroplasts or cell walls. Which means they either don't have those things...
  61. Biology

    in cattle a dominant gene (N) results in a deep notch in each ear. a recessive gene (n) results in an "udder" abnormiality when in the homozygous condition. a farmer desires to rid his herd of these characteristics. which of these two alleles would be easiest to eliminate from...
  62. Biology

    In many tissues, one of the earliest responses to cellular injury is the rapid increase in the levels of the enzymes involved in the pentose phosphate pathway. Ten days after an injury, heart tissue has levels of glucose-6-phosphate dehydrogenase and 6-phosphogluconate ...
  63. Biology

    Which features are common to all cells? Check all that apply. All cells have cytoskeleton lysosomes vacuoles the cytoplasm flagella and fimbriae photosynthetic membranes the plasma membrane ribosomes the cell wall genetic information (DNA) in chromosomes chloroplasts the ...
  64. biology

    What is the source of energy driving the hydrolic cycle? a. evaporation of the ocean water b. heat conducted from the earth's core to the surface c. radiant heat from the sun d. air currents returning to the earth's surface I chose a) evaporation of the ocean water. but after ...
  65. biology

    ) To test linkage between the feather texture and feather color genes you complete a test cross with the F1, and find that the feather texture and feather color genes are linked. Only part of the data from the test cross is given below. Complete the table by giving the four ...
  66. Biology

    Wine is made by mixing yeast with grapes and allowing the yeast cells to undergo fermentation. Sparkling wine is a type of wine that contains high levels of dissolved carbon dioxide. What is the source of the carbon atoms in the carbon dioxide found in sparkling wine? ethanol ...
  67. Science(check answers)

    I printed out a summer activite to test my skill on science and i found some that i stumbled upon and couldn't figuire out so help? If im wrong then please correct me. 2.A 3.B 4.B 5.A 6.B 2.Giraffes have long necks that allow them to eat leaves in trees. What is this an ...
  68. 7th Grade Science Help Please

    For his science project, Austin wants to determine if the pH of standing rainwater and places it indoors in a spot that does not receive a lot of sunlight to limit evaporation. Using a pH testing kit, he measures the pH of the water once a day for 20 days. What is the ...
  69. Science Fair

    I'm planning on doing a science fair project, but it has to involve an experimen. I wanted to do it on how adding mayonnaise, ketchup, and mustard to a small hamburger at McDonalds can so much fat to it that it can make it as bad as a big hamburger without the mayo, ketchup, ...
  70. Biology - Pregnancy

    "If the ovaries were removed between the start of pregnancy and the second month then.....because....." "If the ovaries were removed after the second month....." I'm confused because I thought that once pregnancy begins, no more ovulation occurs until pregnancy is over. So I ...
  71. biology - temp on enzymes

    I have a practice question and I need some help on it because I am rather confused! 'Investigation into the effect of temperature on enzyme activity' -Casein is an insoluble milk protein found in powdered milks -Casein forms a whits suspension which clears if the casein is ...
  72. biology

    What are endergonic reactions? How can endergonic reactions proceed in organisms? An endergonic reaction is a chemical reaction where the reactants have a lower free energy than the products. Enderonic reactions are coupled to exergonic reactions which cause the release in ...
  73. Science 8R - Volume Lab

    I doing this lab for my science class about volume. In class today I collected my data. I measure the regular solid (LxWxH) and as for the irregular solid I use water displacement by putting the irregular solid (that is small) in the graduated cylinder full of water and you ...
  74. Biology

    17. When errors in nucleotide sequencing occur, a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...
  75. Biology

    17. When errors in nucleotide sequencing occur, a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...
  76. Math

    You have 34 math and science problems for homework. You have 10 more math problems then science, how many of each do you have?
  77. biology

    Can someone help? I don't understand gene regulation. The regulation of protein synthesis in cells involves the coordination of several different mechanisms. Discuss TWO of the specific mechanisms of gene regulation in eukaryotic cells from the list below and describe how the ...
  78. biology

    1. From one molecule of glucose, which process generates the largest amount of ATP? a. Glycolysis in a prokaryotic cell under aerobic conditions b. Glycolysis in a eukaryotic cell c. the TCA (Krebs) cycle in a prokaryotic cell d. the TCA (Krebs) cycle in a eukaryotic cell e. ...
  79. Biology

    Bio question relating to the respiratory tract? Recent research has shown that cigarette smoke may result in the following: i.)Destruction of the cilia that line parts of the respiratory system ii.) Rupturing the walls of the same alveoli iii.) Thickening of the walls of the ...
  80. Science

    A wooden block is submerged in a tank of water and pressed down against the bottom of the tank so there is no water underneath it. The block is released. Will it rise to the surface or stay where it is? I think it will rise to the surface because of the air holes coming out. ...
  81. biology

    analogy of a cytoskeleton enter Cytoskeleton Tutorial http://www.ccps.k12.va.us/news_release/rh/cell_biology.htm
  82. Gr 11 Biology

    Which person do you think would be more physically fit: a) an individual with a normal expiratory reserve volume and high vital capacity OR B)an individual with a high expiratory reserve volume and normal vital capacity
  83. Biology

    What ABO antigens are present on the red blood cells of Mr. Green's blood? Mr. Green Anti A serum - no clump Anti B serum - clump Anti Rh serum - no clump
  84. biology

    The ability to roll the tongue (R) is determined by a dominant gene while the recessive gene results in the ability to roll the tongue (r). A man and his wife can both roll their tongues and are surprised to find that their son cannot. Explain this by showing the genotypes of ...
  85. Biology

    An example of homologous structures would be our front teeth and ___: a. the mandibles of a crab b. the mouthparts of a mosquito c. the beak of a bird d. the tentacles of a sea worm e. the front teeth of a horse I'm having difficult on which answer is right (my answer would be...
  86. AP Biology

    A biologist measured the amount of DNA in several single diploid cells taken from a culture. He knew that these cells could divide mitotically, but not meiotically. His data is shown below: Cell Number and DNA content in micrograms: Cell 1 (11.1 micrograms) Cell 2 (5.4 ...
  87. biology

    a class of pupils obtained results on a bar chart during a seashore investigation. they sampled the numbers of different seaweeds found in 0.25 m2 from the top shore (upper shore) to lower shore and found average percentage cover for each seaweed. describe how the pupils would...
  88. Arithmetic

    A box in a college bookstore contains books, and each book in the box is a history book, an English book or a science book. If one-third of these books are history books and one-sixth are English books, what fraction of the books are science books?
  89. human biology

    does DNA serve as a template for just DNA or mRNA as well? Go here: http://www.stanford.edu/group/hopes/treatmts/pbuildup/h2.html and scroll down to: How can RNAi be used to treat HD?
  90. Science

    What is science?
  91. science

    What is science?
  92. Science

    1L = ?cL
  93. science

    What is science???
  94. science

    what is O2??
  95. science

    what is the science?
  96. science

    what is gu?
  97. science

    how do you get help?
  98. science

    what is a science
  99. science

    what is science?
  100. science

    what is science????
  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. 16
  18. 17
  19. 18
  20. 19
  21. 20
  22. 21
  23. 22
  24. 23
  25. 24
  26. 25
  27. 26
  28. 27
  29. 28
  30. 29
  31. 30
  32. 31
  33. 32
  34. 33
  35. 34
  36. 35
  37. 36
  38. 37
  39. 38
  40. 39
  41. 40
  42. 41
  43. 42
  44. 43
  45. 44
  46. 45
  47. 46
  48. 47
  49. 48
  50. 49
  51. 50
  52. 51
  53. 52
  54. 53
  55. 54
  56. 55
  57. 56
  58. 57
  59. 58
  60. 59
  61. 60
  62. 61
  63. 62
  64. 63
  65. 64
  66. 65
  67. 66
  68. 67
  69. 68
  70. 69
  71. 70
  72. 71
  73. 72
  74. 73
  75. 74
  76. 75
  77. 76
  78. 77
  79. 78
  80. 79
  81. 80
  82. 81
  83. 82
  84. 83
  85. 84
  86. 85
  87. 86
  88. 87
  89. 88
  90. 89
  91. 90
  92. 91
  93. 92
  94. 93
  95. 94
  96. 95
  97. 96
  98. 97
  99. 98
  100. 99
  101. 100