science, biology

40,412 results, page 66

statistics

Paul received a score of 80 on a history test for which the class mean was 70 with a standard deviation of 10. He received a score of 75 on a biology test for which the class mean was 70 and the standard deviation was 2.5. On which test did he do better relative to the rest of...

biology

Which have cells walls? (more than one may be correct) A)chilomonas B)volvox C)peranema. Which have chloroplasts? (more than one may be correct) A)Paramecium B)Amoeba C)chilomonas D)volvox E)peranema

Biology! pleaseee helppp

About 70% of the human population can taste the bitter chemical phenylthiocarbamide (PTC), which is found in foods like broccoli. The allele, T, for tasting PTC is dominant over the allele, t, for not tasting it. Calculate the allele frequencies using the Hardy-Weinberg ...

biology

what salts are present in the composition of human sweat. Find out what elements are present in the composition of human sweat and what salts are formed by these elements.

Science

Can a recessive trait be a dominant trait as well? I ask this because I have a science problem that says this: A Bb guinea pig crosses with a Bb guinea pig, and four offspring are produced. All the offspring are black. Explain how this could happen. I tried making a Punnett ...

Math

Gerald can complete a math assignment in 2 hours and a physics assignment in 1 hour. If he has 8 hours to complete a set of assignments, how many math assignments can he complete if he decides to leave the science assignments for the next day? This situation is given by 2x + y...

Math

On tuesday you all took the science and then your social studies final exams. What is the probability of you passing your social studies final exam given that you know that you passed your science final exam first ? The probability of you passing both is 50% and the ...

Biology

1. In females the first meiotic cell division produces____cells. 2. One of the cells is ___ than the other and is called ______. 3. The polar body stays attached to the ____. 4. The larger cell is called the _____ and it mature into _____. 5. The second meiotic cell division ...

Biology

Which is the correct base pairing: Adenine - Guanine Adenine - Cytosine Thymine - Guanine Thymine - Adenine Cytosine - Thymine

Math

A total number of 121 people came to the school science fair this year. This number is 7 MORE than TWICE the number of people who came last year's science fair. How many people came last year?

science

Science Experiment Determine a mathematical modelwhich describes the height of a ball in terms of th number of bounces after it has been droped from a given height. If a ball that bounces like a tenniis ball, is dropped from a given height, then it will bounce to a height less...

physical science

how does matter connect to science? how does matter connect to the world? how does matter connect to you? how does matter connect to math?

Biology

In goats, the allele for black hair is dominant to that for red. Two black haired goats mated, producing twelve offspring. Of the first eleven, 8 had black hair and 3 had red hair. What is the probability of the twelfth offspring having red hair?

biology

A cross between two pea plants with axial flowers and inflated pods gives the following offspringg: 20 with axial flowers and inflated pods, 7 with axial flowers and constricted pods, and 5 with terminal flowers and inflated pods. What is the most probable genotype for the two...

college algebra

23. In biology, the function defined by g(x)=5x/2+x gives the growth rate of a population for x units of available food. (Source: Smith, J. Maynard, Models in Ecology, Cambridge University Press.) (a) What amount of food (in appropriate units) would produce a growth rate of 3 ...

Biology

Which onf of the following statments about sense resceptors is trus? A) Chemicals, light and pressure convert stimuli into electrical impluses. B) Electrical impluses within the nerve pathways trigger an awareness of stimuli in the sensory receptors. c) Sensory receptors are ...

Biology

16. During DNA replication, all of the following steps occur EXCEPT a. enzymes proofread new strands for errors and correct them b. the double helix is unwound by DNA polymerases c. base-pairing rules determine which nucleotide is added to new strands d. each strand of a DNA ...

Biology

In one signaling pathway, cyclic AMP (or cAMP) acts as a second messenger in a series of reactions that result in the relaxation of smooth muscle cells in artery walls. Define cyclic AMP and describe the role and properties of a second messenger. Then explain how a medication ...

science-due tommorow please help!!!!!!!!!!

we are reading catching fire. we have a mini project to do. there are 17 questions and i couldn't find 4. so my questions are : 1. what is healing capacity of salt water? 2. why does salt water have those positive effects on us? 3. what is saline solution rinse? 4. what ...

AP Biology

I'm working on a lab to show that light reactions must occur prior to dark reactions in photosynthesis. so far, i thought of the experiment involving two plants, one exposed to sunlight, the other is kept in a box. both receive the same amount of water soil, etc and both are ...

Biology

The original high estimate of the number of protein-coding genes in humans was based partly on the number of different known proteins made by the human organism. How can the small number of genes now thought to be present account for this larger number of proteins synthesized ...

Biology

Two purple flowers (Bb) are bred with each other in the same garden. What are the odds that red (BB) and blue (bb) flowers will occur in the second generation? A. 50% red flowers; 50% blue flowers B. 25% red flowers; 75% blue flowers C. 75% red flowers; 25% blue flowers D. 25...

ant101

How does the identification of cultural universals impact our understanding of what it means to be human? How does the search for universals help us better understand human cultural behavior? What examples from your own culture can illustrate the ideas that our behaviors are ...

Biology

The ability to roll the tongue (R) is determined by a dominant gene while the recessive gene results in the inability to roll the tongue (r). A man and his wife can both roll their tongues and are surprised to find that their son cannot. Explain this by showing the genotypes ...

biology

a biologist prepared a strip of agar (a gelatin- like substance) as shown in the figure below. at position 7, he placed a concentrated sample of amino acid A and at position 1, a concentrated sample of enzyme E. E is known to catalyze the conversion of A to a product P. Assume...

biology

a biologist prepared a strip of agar (a gelatin- like substance) as shown in the figure below. at position 7, he placed a concentrated sample of amino acid A and at position 1, a concentrated sample of enzyme E. E is known to catalyze the conversion of A to a product P. Assume...

Biology!!

1. what's a huge difference between the chemical equations for Respiration and Alcoholic fermentation &... What determines whether a facultative organism will go through respiration or fermentation *For the first part of the Question, (I looked it up but I wasn't sure if it's ...

biology

1. Toward what condition does diffusion eventually lead, in the absence of other influences? 2. How is osmosis related to diffusion? 3. If the concentration of solute molecules outside a cell is lower than the concentration in the cytosol, is the external solution hypotonic, ...

biology

4pts((all(or(none): Q1:(Draw(a(gene(with(three(exons(on(the(line(below. The(coding(region((ORF) is(completely(contained(in(the(second(exon. Make(sure(you(annotate(the(following(regions: TSS 5’UTR(all(regions) Coding(sequence 3’UTR(all(regions) AATAAA(sequence 5’(Donor(...

Biology

I have to write 2-4 sentences on these questions. Can I please get some help? 'Both animal and plant cells undergo cytokinesis after mitosis ends. a) How is the process and its outcome same for both animal and plant cells? b)How is the process and its outcome different for ...

Biology

I have to write 2-4 sentences on these questions. Can I please get some help? 'Both animal and plant cells undergo cytokinesis after mitosis ends. a) How is the process and its outcome same for both animal and plant cells? b)How is the process and its outcome different for ...

Biology

In the cyclic reaction sequence called the krebs cycle, which chemical event does not take place? a.The acetyl group is joined with a four carbon molecule, oxaloacetate. b. Two carbons per cycle are made into CO2 molecules. c. Electrons generated are used to produce NADH. d. ...

Biology Research Paper

Is this alright as my 'hooking' beginning? We find it mixed in our food on the shelves in the supermarket, we find it growing in a plot down the lane, test field release sites with genetically engineered rape seed, sugar beet, wheat, potato, strawberries and more. It is ...

Biology

A couple has a child with an autosomal recessive form of glycogen storage disease, a deficiency of a lysosomal enzyme. An enlarged liver and heart and weak muscles cause the baby to die from heart and lung failure at 20 months. Now the woman is pregnant again. Her doctor ...

science

Describe the process by which a fungus feeds. A fungus feeds first by growing hyphae into the food source. Then chemicals ooze from the hyphae into the food source. The chemicals break down food into substances that the hyphae are able to absorb. I used our science book. Our ...

Biology

hi! so I have to make an experiment on heat loss & insulation and so, I did an experiment on which material insulates best against the wind of a fan--styrofoam, plastic or aluminum can. each has hot water in it but the styrofoam took the longest for the hot water to cool ...

Biology

Tube # 1: 1 ml of water, 3 ml of glucose-1-phosphate and 3 ml of Enzyme. Tube # 2: 1 ml of Ph 7 buffer, 3 ml of glucose-1-phosphate and 3 ml of Enzyme. Both of these reactions tested positive, and the same enzyme was used for both tubes. Why Did you get get a positive reaction...

Biology

Brown eyes in humans are dominant to blue eyes. A brown-eyed man, whose mother was blue-eyed, marries a brown-eyed woman whose father had blue eyes. What is the probability that this couple will have a blue-eyed child?

biology - dna

If a DNA double helix is gradually heated, which bonds in the molecule will break first (are the weakest)? A. bonds between the nitrogenous bases B. bonds between the bases and the sugars C. bonds between the sugar and phosphate within a nucleotide D. bonds between the sugar ...

Biology

I have a research article about the early advancement of laying times for Flycatchers, a bird species through Europe and Asia. My variables are: - Annual temperature recordings in each study site - The species, flycatcher - Clutch size of the flycatchers - The location of each...

Science (please help me)

I have 2 question on science 7. please help me. 1.state whether each substance is a mechanical mixture, a suspension, or a solution. My answers are at the bottom. a)green relish b)soda pop in a glass c)bubble tea d)traditional Aborigial paint made of red orchre and grease my ...

Biology

In regards to color-blindness, I have a question! (Please make sure to note how the trait is passed on first.) If a woman is affected by colorblindness are both of her parents carriers or just one? What if a man is affected - do both of his parents have to be carriers for the ...

physical science

Please check my answers on this physical science quiz, thanks 1. in which of the following scenarios are action and reaction forces involved? a. when a tennis racket hits a ball b. when you step from a curb c. when you row a boat d. all of the above** 2. the product of an ...

Biology

Darwin was able to formulate his theory of evolution based on several facts. Which of the following facts was unavailable to Darwin in the mid-nineteenth century? Natural resources are limited. Individual organisms in a population are not alike. Characteristics are inherited ...

Biology (genetics)

The RAS protein acquires a mutation that prevents release of GTP. Which of the following characteristics are these cells likely to acquire? a)Self-sufficiency in growth signals b) insensitivity to anti growth signals c) angiogenesis d) metastasis e) blocking apoptosis I ...

Biology

The shrunken gene of wheat encodes a large enzyme that converts glucose to starch in its grains. How would insertion of a 1 kb transposon into codon 23 of this gene affect the protein produced from this allele? A. The protein would be longer and still functional. B. The ...

science

49. A researcher writes a grant proposal to repeat an experiment that was recently published by another researcher. Which of the following statements best supports the grant proposal? A. Funding this grant proposal will allow this laboratory to continue to study this topic. B...

human biology

I need some information on the nephron and H+ ions. My book just has it in a diagram, but the diagram talks mostly about the K+ ion relationship. Can someone just give the gist of the H+ relationship with the nephron? thanks Since this is not my area of expertise, I searched ...

literature (bejamin Franklin)

I have one more confusing question regarding this. And Thank you Ms.Sue for answering the last question! Franklin's humor in Witch Trial at Mt. Holly depends upon the belief that... a)the belief that religion takes precedence over science b)the belief that the physical laws of...

Biology

a genetisict studying coat color in animals crosses a male bunnicula having the genotype CC with a female having genotype Ccand the little subscript letters ch. The geneticist then crosses a cc(small letters ch) male with a Cc(small letter c) female. make a punnet square for ...

Biology

What happens when a substance dissolves in the watery solution outside of a cell and equilibrium is disrupted. a. Water from the cell will move into the solution b. water from the solution will move into the cell c. the pores in the cell membrane will become clogged with the ...

biology

polar molecule are soluble in water. how does this activity demonstrate polarity of molecule that contain the -OH group. our activity was to do an experiment mixing 2 diff liquids together to see if they dissolve and tell if its polar or nonpolar. 1. water and oil= polar 2. ...

Biology

When errors in nucleotide sequencing occur,? a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide. b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one. c. purines replace pyrimidines in the DNA molecule. d. DNA ...

Biology and Graphing (Stats)

i need to make a graph on excel.. my data involve putting goldfish (from the same tank and same type) into 3 different environments : acidic, neutral (control), and basic. What kind of graph should I use? just a line graph? but then what should my variables look like? the 3 ...

Biology

After a strain of bacterial cells is exposed to a chemical mutagen, only 30% of the cells produce new colonies that continue to grow. Which of the following can be concluded? A. Some cells underwent advantageous mutations. B. Some cells underwent neutral mutations. C. Some ...

Biology

How do the kidneys clean the blood? (1 point) • Kidneys clean the blood by breaking down nutrients. • Kidneys clean the blood by filtering it to remove wastes. • Kidneys clean the blood by absorbing nutrients. • Kidneys clean the blood by destroying microbes and ...

science

list as many ways as u can how are crystalline solids connected to science? how are crystalline solids connected to math? how are crystalline solids connected to the world? how are crystalline solids connected to you? why is it important?

math lit, geography, life science,business studies

hey there! what career can do with math lit, geography, life science and business studies?

Biology

1. Meiosis occurs during the production of gametes_______ within the sex organs. It is a type of division that reduces the chromosome number from the _____ number to the _______ number. 2.The _______pairs of chromosomes are called________. During meiosis the homologus ...

Biology

In order to predict the percentage of males and females three assumptions must be considered: 1. The X carrying sperm and Y carrying sperm have an equal chance of fetilization: 2. The egg and sperm combine at random: 3. the XX and XY zygotes have equal chance of development at...

biology

Below the human hemoglobin sequence are the first thirty amino acid sequences of several other species’ hemoglobins. Inspect the sequences and answer the following questions: Human) h l t p e e k s a v t a l w g k v n v d e v g g e a l g r l A) ml t a e e k a a v t a f w g k...

Biology

What is the targeting pathway from translation until the protein reaches it's final functional destination for PFK and insulin? Choose from the following choices for each: a) golgi -> ER -> outside of cell b) ER -> golgi -> cytoplasm c) cytoplasm only d) nucleus -&...

Biology

Technology is equipment used to do something or make something. Biochemical technology or biotechnology refers to the use of living organisms for the formation of products useable by humans. Recombinant DNA technology is one type of biotechnology. List the steps involved in ...

Biology (Answer Check)

State how comparing the amino acid sequence of a protein can provide evident that evolution has taken place. A: If evolution has taken place, then, in general, species descended from a recent common ancestor should have fewer amino acid differences between their proteins than ...

Biology

All cell are surrounded by membranes. The main role of the cell membrane is to A.regulate the cell's interactions with the environment b.release any type of molecule out of the cell c.arrange the cell's organelles in the cytoplasm d.prevent water from leaking out of the cell ...

Biology

All cell are surrounded by membranes. The main role of the cell membrane is to A.regulate the cell's interactions with the environment b.release any type of molecule out of the cell c.arrange the cell's organelles in the cytoplasm d.prevent water from leaking out of the cell ...

Biology

In most Hymenoptera, all fertilized eggs develop into diploid females and all unfertilized eggs into haploid males-a condition known as haplodiploidy. Workers in these colonies share half the alleles they received from their mother, but share all of the alleles they received ...

Biology

Conducting cells in xylem are: Sieve tube elements Tracheids Tracheids and vessel elements Vessel elements Tracheids and sieve tube elements please help with my homework thanks.

Biology

A farmer planted a field of Bt 123 corn and wants to estimate the yield in terms of bushels per acre. He counts 22 ears in 1/1000 of an acre. He determines that each ear has about 700 kernels on average. He also knows that a bushel contains about 90 000 kernels on average. ...

biology

6. A farmer planted a field of Bt 123 corn and wants to estimate the yield in terms of bushels per acre. He counts 22 ears in 1/1000 of an acre. He determines that each ear has about 700 kernels on average. He also knows that a bushel contains about 90 000 kernels on average. ...

Biology - please help

After a strain of bacterial cells is exposed to a chemical mutagen, only 30% of the cells produce new colonies that continue to grow. Which of the following can be concluded? A. Some cells underwent advantageous mutations. B. Some cells underwent neutral mutations. C. Some ...

Biology

Father has red/green color blindness and is a hemophiliac. Mother is normal. Have two female children (Both are probably carriers). One female offspring marries a normal male. The question is what is the probability that their son is both color blind and hemophiliac? ...

Biology

J.J. Thomson's experiments supported the existence of a particle that deflected away from a negative charge and toward a positive charge. Ernest Rutherford found that when positive particles were fired at gold foil, some of the particles deflected rather than passing straight ...

Biology - Please check?

How does artificial selection differ from natural selection? (Free response) Here is what I wrote: While both of these selections have to do with breeding, artificial selection (same as selective breeding) is where either plants or animals are intentionally bred for scientific...

Biology

Pollen transport in flowers Pollination is the transfer of pollen containing male sex cells from the stamens of a plant to the pistil containing the eggs. Afterward a pollen tube grows through the pistil and sperm nuclei migrate to the egg where fertilization (union) takes ...

Biology

Which phrase does NOT describe one of the functions of proteins of the plasma membrane? -forming a channel through the membrane -initiating the replication of the genetic material (CORRECT) -binding to a substance to carry it through the membrane -acting as a pump to move ions...

biology / CELEISTINE

describe the genetics of the huntigton disease a. what chromosomes are affected? b. is it a result on translocation/ c. is it a sex-linked? d. does it skip a generation 3. waht are the cause of huntington disaese? how does it occur ? is it preventable ? how ? 4. waht are the ...

bio

given: 6 fingers is an x-linked trait and is recessive (5 fingers being dominant question: if you have a father with 6 fingers and a mother that has 5 fingers, but carries the 6 finger trait, what is the chance that they will have a child with 6 fingers? You can do this on a ...

Public High School AP Biology

I got a question that comes from the 1990 released test #61 that I'm completley lost on 61. In a population that is in Hardy-Weinberg equilibrium, the frequency of a recessive allele for a certain hereditary trait is 0.20. What percentage of the individuals in the next ...

Public High School AP Biology

I got a question that comes from the 1990 released test #61 that I'm completley lost on 61. In a population that is in Hardy-Weinberg equilibrium, the frequency of a recessive allele for a certain hereditary trait is 0.20. What percentage of the individuals in the next ...

cp biology

include the following vocabulary when completing the concept map. be sure to PLACE THE WORDS in the correct step of the scientific method, and DISCUSS what occurs at each step. words: qualitative data quantitative data independent variable data analysis/ interpretation law ...

Biology

Danielle was born with a birth defect which resulted in a lack of primary auditory cortex formation. Which of the following will likely result? a. Danielle will not be about to hear from her right ear. b. Danielle will not be able to hear at all. c. Danielle will need to get ...

Biology

Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5: GCCAAGGCACTACGCTACGTCGCATTATAC ...

PHSICS

1. How much kinetic energy does a 1 kg ball have if it has a velocity of 10 m/s? Choose one answer.and explain a. 100 J. b. 50 J. c. 10 J. d. 5 J. 2. You have the grand idea that the science building would be better situated if you moved it North by 4 meters. To accomplish ...

Science

Jordan is doing a science fair project on the effects of music and growth of tomatoes.he has two tomato plants, plant A and plant B that he grows in a window and gives the same amount of water. Plant A is exposed to classical music using headphones atttached to the soil. ...

Biology:renal clearance

i want to calculate the renal clearance of creatinine. rate of urine production=0.8ml min-1 creatinine concentration in urine is 15.7 mg ml-1 Thank you for using the Jiskha Homework Help Forum. A good site for kidney problems is DaVita: http://www.davita.com/

biology

Make a single base pair substitution mutation in the gene below that results in a protein that is shorter than the protein produce by the original gene. When you are satisfied with your change and its effect, click the "Final Check" button. Note that a "single base pair ...

ENGLISH

In which of the following sentences is the semicolon used correctly? A. There were five items on the kitchen counter; a coffeemaker, a bag of beans, agrinder, a sugar bowl, and a cracked cup. B. At first Icouldn't make out what kind of bird it was,but as I swooped low, I ...

Biology

When dental work is to be done, the gums and nerves in the teeth are anethetized by injection of lidocaine. This drug blocks Na+ channels in the membrane of the sensory cells. This drug is an effective local anesthetic because the A. Sensory cell membrane do not repolarize ...

BIOLOGY

Life cycle of a human being? http://www.nationmaster.com/encyclopedia/Human#Life_cycle

Science(check answers)

I printed out a summer activite to test my skill on science and i found some that i stumbled upon and couldn't figuire out so help? If im wrong then please correct me. 2.A 3.B 4.B 5.A 6.B 2.Giraffes have long necks that allow them to eat leaves in trees. What is this an ...

7th Grade Science Help Please

For his science project, Austin wants to determine if the pH of standing rainwater and places it indoors in a spot that does not receive a lot of sunlight to limit evaporation. Using a pH testing kit, he measures the pH of the water once a day for 20 days. What is the ...

Science Fair

I'm planning on doing a science fair project, but it has to involve an experimen. I wanted to do it on how adding mayonnaise, ketchup, and mustard to a small hamburger at McDonalds can so much fat to it that it can make it as bad as a big hamburger without the mayo, ketchup, ...

English

I forgot to add these few more things. They are really urgent. Thank you. 1) I told my collegues about the possibility of carrying out a Comenius project on how to write the screenplay and shoot (make) a film. 2) As a matter of fact, they would rather be involved in a project ...

Biology

In a lab on lung capacity where lung volumes (Tidal Volume, Expiratory Reserve Volume, Inspiratory Capacity, Inspiratory Reserve Volume, and Vital Capacity) are measured... Why can't you measure the Inspiratory Reserve Volume (IRV) directly? (In the procedure it says to do IRV...

Biology

In a lab on lung capacity where lung volumes (Tidal Volume, Expiratory Reserve Volume, Inspiratory Capacity, Inspiratory Reserve Volume, and Vital Capacity) are measured... Why can't you measure the Inspiratory Reserve Volume (IRV) directly? (In the procedure it says to do IRV...

biology

A true breeding brown mouse is mated with a true-breeding white mouse and all their offspring are brown. If two of these brown offspring are mated, what percentage of the F1 and F2 generations will be brown?

mathematics

in a class of 60 students, the number of students who passed biology is 6 more the number of student who passed chemistry. Every student passed at least 1 subject and 8 passed both subject. How many passed chemistry

biology

Predict the expected change to blood flow should norepi act on arteries of the abdominal cavity? A. Blood flow increases B. Blood flow decreases C. Blood flow stays the same but pressure increases D. Blood flow stays the same but speed decreases E. None of the Above

Biology

Which of the following statements correctly compares the functions of a plant's roots and stem? The stem contains a high percentage of cells that provide structural support, unlike the roots. The stem is the first part of the plant to emerge from a seed, followed by the roots...

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92
  93. 93
  94. 94
  95. 95
  96. 96
  97. 97
  98. 98
  99. 99
  100. 100