science, biology

40,352 results, page 18

Biology

why is a cell small? and how can this be related to the diffusion rate and the synthetic capacity?

Biology

why is a cell small? and how can this be related to the diffusion rate and the synthetic capacity?

biology

What physiological response helped John to survive this heart attack?

biology

what are the four main sources or causes of disease causing agents?

Biology- PLEASE HELP ME ):

how does the salinity of a solution affect osmosis in an onion cell?

biology

what forms between the other two primary tissue layers

Biology 1

What is a Biochemical cycle and why is it important? Give at least one example.

Biology

Does the circulatory system transport red and white blood cells? If so, how?

Biology

true or false Ciliates use flagella for feeding and movement?

BIOLOGY

WHAT ARE THE COMPLEMENTARY BASE SEQUENCE FOR THE FOLLOWING DNA MOLECULE: GCCTACGATGCTTGTACTGAA

Biology

How could a farmer tell whether his tomatoes are pure red or heterozygous?

biology

What is a possible system that can be used to test respiration in a small animal?

biology

Describe the concept of natural selection. Give some examples.

biology

why does it make a difference if you measure metabolic rate in terms of o2/animal or o2/g

environmental biology

Why would be important to study extreme habitat and extremophiles?

biology

Our cat had a litter of kittens yesturday . What characterists is this?

Biology

Can someone tell me what I can look up to find the cell that is abundant in pus?

Biology

is the reaction of calcium chloride with sodium carbonate ionic or covalent

biology

How would you measure chloride current during an action potential

biology

explain why the synthesis of proteins, DNA and RNA requires energy. thanks :)

biology

depict the following dilutions series: 1:4 1:16 1:64 IN A FINAL VOLUME OF 200ML

BIOLOGY

HOW COULD USING AQUACULTURES IMPACT THE BIODIVERSITY OF WILD FISH POPULATIONS?

biology

Name the 4 factors that control the amount and rate of gas exchange.

Biology

2) Why can it be said that each glucose molecule runs the Krebs cycle twice?

Biology

Why is proper microscope technique important for studying Anatomy and Physiology?

biology

Describe the to type of energy changes that can occur in a chemical reaction Thanks

Biology

How are soldier crabs useful to us and what things are humans doing to wipe them out?

biology

do reduced or oxidized forms of carbon carry more energy?

biology

how could you set up an experiment to show that the oxygen is coming from the plant and not from the water???

Biology

Is denitrification a biological or chemical process or both? Explain your answer.

Biology

What are the similarities of the evolution of birds on hawaiian islands and the finches on the Galapagos?

Biology

What are the similarities of the evolution of birds on hawaiian islands and the finches on the Galapagos?

Biology

I can't figure out these brain teasers: i.e.point act char er ILL GET IT

Biology

Another brain teaser I can't get: What are Mr. Rahn's favorite states" Hint: "it matters"

Biology - genetics

How does crossing over change the combination of alleles in gametes? Thanks :)

biology

Which are more closely related... Ants and Bees or Flies and Beetles... Thanks! :)

Biology

How many grams of NaCl do you need to make 150ml of a 0.8M stock solution?

biology

How does a glycerol mulecule differ from a carbohydrate molecule? Structeral formulas

Biology

Why is knee-jerk reflex exaggerated after the book is clenched?

Biology 9th grade

Describle the following cellular structures and functions?

biology

Why are antibiotics and vitamins not normally autoclaved when preparing microbiological media?

BIOLOGY

Why does the quadrant streak technique able to give single colonies?

biology question??

explain how Eukaryotic cells are attached to eachother? why is it important??

Biology

WHAT CELL PART AIDS IN MOVEMENT AND INCREASES THE SURFACE AREA?

biology

provide information the muscles found within the forearm and hand

biology

would you expect whitefish embryo cells to divide indefinitely?

biology

Which of the following amino acids has the most hydrophilic side chain? A. F B. Q C. V D. M E. A

biology

what is theoffspring of a yellow seed and a green seeds genotype and phenotype?

Biology

What is a cross between plants that involves one characteristic called

biology

property of muscle in which the strength of its contraction can vary from weak to strong

Biology

What is the significance of the different length: volume ratios of the digestive organs?

Biology

Explain what is meant by source to sink flow in phloem transport.

Biology

Why is it difficult for a mutation to occur that would change the genetic code?

Biology

Identify the molecules that participate in the light dependant reactions and tell what they do.

biology

What are four negative allosteric effectors in the citric acid cycle

biology

Explain how new species can originate without geographical barriers.

need help biology

is a community the population in a given area or is that an ecosystem and give ex

biology

Covalent bonds are not affected by chemical reactions. true ir false

BIOLOGY

Why is a control set-up being done in the conduct of an experiment? Give example.

Biology

Why is a control set-up being done in the conduct of an experiment. Give Example.

biology

similar abd difference between photosynthesis and cellulaR RESpiration

Biology

What 3' to 5' DNA sequence would correspond to a 5'-AUG-3' start codon?

Biology

Briefly describe how the process of dehydration synthesis creates polymers.

BIOLOGY 12

Explain the path of deoxygenated blood from the right atrium to the lungs

biology

What are some factors that might slow destruction of the rain forest?

biology

what are three ways that DNA mutation can alter genetic material?

Biology

How animal cells compensate the function performed by vacuoles in plant?

Biology

1. Describe 2 methods of viral infection 2. How can a virus be helpful to its host? Thank you:)

biology

Describe Charles Lyell's geological theory about uniformitarian

Biology

Describe the ATP molecule and it's function within a cell ????????????????please help??????????

biology

explaination of the scientific interpretation of fossils found in the cradle of humankind

Biology

For yogurt, draw a representative molecule of amino acids it contains.

Biology

Please Give 10 statements to prove that plants can reproduce sexually.

biology

the release of waste into the enviroment. i need the word to this definition.

biology

the manufacturer of carbohydrates, fats, and proteins. whats the word to this definition?

Biology

How do the two ATP molecules charge the glucose molecule in glycolysis?

Chemical Biology

Which fruits or vegetables or plants do not contain catalase enzyme?

Biology

Where does the carbon cycle end? My project asks this, but I can of no specific "ending."

Biology

Which of the following sequences is an example of a point mutation of the DNA sequence -A-A-G-T-G-C- ? (What?) -A-A-A-T-G-C- -A-A-G-U-G-C- -G-T-A-G-A-A-C- -A-A-G-G-T-C-

english

Who can give me a topic for research paper related to marine biology?

biology

What does it mean when pea plants are described as being true breeding?

biology

What is the role that sensors play in the maintenance of homeostasis in the human body?

Evolution/Biology

What does the statement "The environment directs natural selection" mean?

Biology

20.   Which of these is the smallest structure?  A. Dipeptide B. Polypeptide C. Protein D. Amino acid

biology

which of the following is a characteristic that could be applied to both living and nonliving things

Biology

how does the number of electrons in an atom determine what kind of bond it can form?

Biology

What roles do survival and reproduction play in the evolution of antibiotic resistance?

Biology

What holds nitrogen bases together in a Double Helix? (DNA)

Biology (or math)

What is the surface area to volume ratio of a cube with a with of 4 cm. I think its 1.5:1

Biology

Why don't we run out of the important gases that we need to stay alive?

Biology

state one reason why the concentration of glucose in the blood increases.

biology

state one reason why the concentration of glucose in the blood decreases.

Biology

How do you think increasing temperature would affect the rate of photosynthesis?

Biology

3'-GGCACTCGCATAATATTCGCCATGGCT -5' In the DNA sequence above, how do i identify the promoter region..

Pure Maths, Biology , Business ,CAT

What can I study in university with these subjects?

biology

If we put few ml.of hydrochloric acid on a piece of the skeleton of a shell

Biology

Name an organ which is formed of tissues of two different individuals.

biology

Pepsin is... A. enzyme B. lipid C. carbohydrate D. nucleic acid I think A!

biology assignment

How are cohesion and adhesion properties of water linked to photosynthesis

Biology

What is the effect of of adding more sugar to a solution? What will happen to its consistency?

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92
  93. 93
  94. 94
  95. 95
  96. 96
  97. 97
  98. 98
  99. 99
  100. 100