science, biology

40,893 results, page 18

  1. biology

    when would and organism need to undergo the process of mitosis and meiosis?
  2. biology

    Where would you be most likely to find a phenylalanine side chain?
  3. biology

    what is a section of DNA that governs physical and behavioral traits called?
  4. biology/poetry

    can someone write me a acrostic poem on the word PHOTOSYNTHESIS, thank you
  5. Biology

    Give an example of a tandem cluster and describe which protein it will produce.
  6. Biology

    Explain your liver's role in changing your blood sugar level
  7. biology

    how is it possible for an enzyne to lower the required energy of activation for a reaction.
  8. biology

    can foreign species improve the stability of the habitat of the native cpecies
  9. biology

    are both ER and secretory vesicles have double bilayer membrane
  10. Biology

    why is a cell small? and how can this be related to the diffusion rate and the synthetic capacity?
  11. Biology

    why is a cell small? and how can this be related to the diffusion rate and the synthetic capacity?
  12. biology

    What physiological response helped John to survive this heart attack?
  13. biology

    what are the four main sources or causes of disease causing agents?
  14. Biology- PLEASE HELP ME ):

    how does the salinity of a solution affect osmosis in an onion cell?
  15. biology

    what forms between the other two primary tissue layers
  16. Biology 1

    What is a Biochemical cycle and why is it important? Give at least one example.
  17. Biology

    Does the circulatory system transport red and white blood cells? If so, how?
  18. Biology

    true or false Ciliates use flagella for feeding and movement?
  19. BIOLOGY

    WHAT ARE THE COMPLEMENTARY BASE SEQUENCE FOR THE FOLLOWING DNA MOLECULE: GCCTACGATGCTTGTACTGAA
  20. Biology

    How could a farmer tell whether his tomatoes are pure red or heterozygous?
  21. biology

    What is a possible system that can be used to test respiration in a small animal?
  22. biology

    Describe the concept of natural selection. Give some examples.
  23. biology

    why does it make a difference if you measure metabolic rate in terms of o2/animal or o2/g
  24. environmental biology

    Why would be important to study extreme habitat and extremophiles?
  25. biology

    Our cat had a litter of kittens yesturday . What characterists is this?
  26. Biology

    Can someone tell me what I can look up to find the cell that is abundant in pus?
  27. Biology

    is the reaction of calcium chloride with sodium carbonate ionic or covalent
  28. biology

    How would you measure chloride current during an action potential
  29. biology

    explain why the synthesis of proteins, DNA and RNA requires energy. thanks :)
  30. biology

    depict the following dilutions series: 1:4 1:16 1:64 IN A FINAL VOLUME OF 200ML
  31. BIOLOGY

    HOW COULD USING AQUACULTURES IMPACT THE BIODIVERSITY OF WILD FISH POPULATIONS?
  32. biology

    Name the 4 factors that control the amount and rate of gas exchange.
  33. Biology

    2) Why can it be said that each glucose molecule runs the Krebs cycle twice?
  34. Biology

    Why is proper microscope technique important for studying Anatomy and Physiology?
  35. biology

    Describe the to type of energy changes that can occur in a chemical reaction Thanks
  36. Biology

    How are soldier crabs useful to us and what things are humans doing to wipe them out?
  37. biology

    do reduced or oxidized forms of carbon carry more energy?
  38. biology

    how could you set up an experiment to show that the oxygen is coming from the plant and not from the water???
  39. Biology

    Is denitrification a biological or chemical process or both? Explain your answer.
  40. Biology

    What are the similarities of the evolution of birds on hawaiian islands and the finches on the Galapagos?
  41. Biology

    What are the similarities of the evolution of birds on hawaiian islands and the finches on the Galapagos?
  42. Biology

    I can't figure out these brain teasers: i.e.point act char er ILL GET IT
  43. Biology

    Another brain teaser I can't get: What are Mr. Rahn's favorite states" Hint: "it matters"
  44. Biology - genetics

    How does crossing over change the combination of alleles in gametes? Thanks :)
  45. biology

    Which are more closely related... Ants and Bees or Flies and Beetles... Thanks! :)
  46. Biology

    How many grams of NaCl do you need to make 150ml of a 0.8M stock solution?
  47. biology

    How does a glycerol mulecule differ from a carbohydrate molecule? Structeral formulas
  48. Biology

    Why is knee-jerk reflex exaggerated after the book is clenched?
  49. Biology 9th grade

    Describle the following cellular structures and functions?
  50. biology

    Why are antibiotics and vitamins not normally autoclaved when preparing microbiological media?
  51. BIOLOGY

    Why does the quadrant streak technique able to give single colonies?
  52. biology question??

    explain how Eukaryotic cells are attached to eachother? why is it important??
  53. Biology

    WHAT CELL PART AIDS IN MOVEMENT AND INCREASES THE SURFACE AREA?
  54. biology

    provide information the muscles found within the forearm and hand
  55. biology

    would you expect whitefish embryo cells to divide indefinitely?
  56. biology

    Which of the following amino acids has the most hydrophilic side chain? A. F B. Q C. V D. M E. A
  57. biology

    what is theoffspring of a yellow seed and a green seeds genotype and phenotype?
  58. Biology

    What is a cross between plants that involves one characteristic called
  59. biology

    property of muscle in which the strength of its contraction can vary from weak to strong
  60. Biology

    What is the significance of the different length: volume ratios of the digestive organs?
  61. Biology

    Explain what is meant by source to sink flow in phloem transport.
  62. Biology

    Why is it difficult for a mutation to occur that would change the genetic code?
  63. Biology

    Identify the molecules that participate in the light dependant reactions and tell what they do.
  64. biology

    What are four negative allosteric effectors in the citric acid cycle
  65. biology

    Explain how new species can originate without geographical barriers.
  66. need help biology

    is a community the population in a given area or is that an ecosystem and give ex
  67. biology

    Covalent bonds are not affected by chemical reactions. true ir false
  68. BIOLOGY

    Why is a control set-up being done in the conduct of an experiment? Give example.
  69. Biology

    Why is a control set-up being done in the conduct of an experiment. Give Example.
  70. biology

    similar abd difference between photosynthesis and cellulaR RESpiration
  71. Biology

    What 3' to 5' DNA sequence would correspond to a 5'-AUG-3' start codon?
  72. Biology

    Briefly describe how the process of dehydration synthesis creates polymers.
  73. BIOLOGY 12

    Explain the path of deoxygenated blood from the right atrium to the lungs
  74. biology

    What are some factors that might slow destruction of the rain forest?
  75. biology

    what are three ways that DNA mutation can alter genetic material?
  76. Biology

    How animal cells compensate the function performed by vacuoles in plant?
  77. Biology

    1. Describe 2 methods of viral infection 2. How can a virus be helpful to its host? Thank you:)
  78. biology

    Describe Charles Lyell's geological theory about uniformitarian
  79. Biology

    Describe the ATP molecule and it's function within a cell ????????????????please help??????????
  80. biology

    explaination of the scientific interpretation of fossils found in the cradle of humankind
  81. Biology

    For yogurt, draw a representative molecule of amino acids it contains.
  82. Biology

    Please Give 10 statements to prove that plants can reproduce sexually.
  83. biology

    the release of waste into the enviroment. i need the word to this definition.
  84. biology

    the manufacturer of carbohydrates, fats, and proteins. whats the word to this definition?
  85. Biology

    How do the two ATP molecules charge the glucose molecule in glycolysis?
  86. Chemical Biology

    Which fruits or vegetables or plants do not contain catalase enzyme?
  87. Biology

    Where does the carbon cycle end? My project asks this, but I can of no specific "ending."
  88. Biology

    Which of the following sequences is an example of a point mutation of the DNA sequence -A-A-G-T-G-C- ? (What?) -A-A-A-T-G-C- -A-A-G-U-G-C- -G-T-A-G-A-A-C- -A-A-G-G-T-C-
  89. english

    Who can give me a topic for research paper related to marine biology?
  90. biology

    What does it mean when pea plants are described as being true breeding?
  91. biology

    What is the role that sensors play in the maintenance of homeostasis in the human body?
  92. Evolution/Biology

    What does the statement "The environment directs natural selection" mean?
  93. Biology

    20.   Which of these is the smallest structure?  A. Dipeptide B. Polypeptide C. Protein D. Amino acid
  94. biology

    which of the following is a characteristic that could be applied to both living and nonliving things
  95. Biology

    how does the number of electrons in an atom determine what kind of bond it can form?
  96. Biology

    What roles do survival and reproduction play in the evolution of antibiotic resistance?
  97. Biology

    What holds nitrogen bases together in a Double Helix? (DNA)
  98. Biology (or math)

    What is the surface area to volume ratio of a cube with a with of 4 cm. I think its 1.5:1
  99. Biology

    Why don't we run out of the important gases that we need to stay alive?
  100. Biology

    state one reason why the concentration of glucose in the blood increases.
  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. 16
  18. 17
  19. 18
  20. 19
  21. 20
  22. 21
  23. 22
  24. 23
  25. 24
  26. 25
  27. 26
  28. 27
  29. 28
  30. 29
  31. 30
  32. 31
  33. 32
  34. 33
  35. 34
  36. 35
  37. 36
  38. 37
  39. 38
  40. 39
  41. 40
  42. 41
  43. 42
  44. 43
  45. 44
  46. 45
  47. 46
  48. 47
  49. 48
  50. 49
  51. 50
  52. 51
  53. 52
  54. 53
  55. 54
  56. 55
  57. 56
  58. 57
  59. 58
  60. 59
  61. 60
  62. 61
  63. 62
  64. 63
  65. 64
  66. 65
  67. 66
  68. 67
  69. 68
  70. 69
  71. 70
  72. 71
  73. 72
  74. 73
  75. 74
  76. 75
  77. 76
  78. 77
  79. 78
  80. 79
  81. 80
  82. 81
  83. 82
  84. 83
  85. 84
  86. 85
  87. 86
  88. 87
  89. 88
  90. 89
  91. 90
  92. 91
  93. 92
  94. 93
  95. 94
  96. 95
  97. 96
  98. 97
  99. 98
  100. 99
  101. 100