how does the structure of DNA contribute to the accurate transmission of hereditary material?

9,254 results

  1. BIOLOGY

    how does the structure of DNA contribute to the accurate transmission of hereditary material? hereditary material Not much help courtney. I'd say its structure utilizing vanderwahls forces allows it to have a quaternary structure which takes up less space. (tightly coiled) Try...
  2. biology PLEASE ASSIST!!

    1.The structure and functions of the cell are controlled by what??? 2.Explain why DNA is able to play a role in the transmission of hereditary information. 3.State TWO functions of DNA 4. Explain how genetic fingerprinting can be used to prove is the identity of the father of ...
  3. life science

    why dna is able to play a role in the transmission of hereditary information
  4. life sciences

    explain why DNA is able to play a role in the transmission of hereditary information
  5. Bio...DNA

    Can anyone explain the relationship between the structure of DNA , protein structure and phenotype of an organism? Also, what is the role of DNA in protein synthesis? I will give you a little hint. The DNA makes the RNA. The RNA makes the proteins by amino acid building blocks...
  6. Biology DNA

    can somebody please explain the relationship between the structure of DNA, protein structure and the phenotype of an organism and the relationship between DNA chromatin and chromosome
  7. Genetics

    Researchers at the University of Rochester studies children born with an infection called roseola. The children also have the causative herpesvirus inserted into their chromosomes. At least one percent of each child had the virus in a chromosome of a sampled hair cell. a. How ...
  8. Science

    How does a mutation in the DNA affect the way proteins are made? A. A mutation in the DNA results in misshapen tRNA molecules that do not fit inside the ribosomes. B. A mutation in the DNA results in a change in the mRNA and, ultimately, to a different protein structure. C. A ...
  9. Science

    How does a mutation in the DNA affect the way proteins are made? A. A mutation in the DNA results in misshapen tRNA molecules that do not fit inside the ribosomes. B. A mutation in the DNA results in a change in the mRNA and, ultimately, to a different protein structure. C. A ...
  10. Biochemisty

    The DNA alpha-helix structure has 566900 complete turns. The average molar mass of one base pair of nucleotides in DNA is approximately 469 g/mol. If the spacing between successive base pairs is about 0.69 nm, and a complete turn in the helical structure of DNA occurs every 6....
  11. AP Chemistry

    Two objects A and B of different size are both at a temperature of 500 K and are connected by a rod (A looks four times larger than b). What will be the nature of transmission of heat? I believe there won't be a transmission of heat. Any thoughts. Here are the options A. ...
  12. Physics

    Stretching DNA. With its double-helix structure, DNA is coiled like a spring. A biophysicist grabs the ends of a DNA strand with optical tweezers and stretches it 26µm producing 1.2pN- tension in the strand. What's the DNA's spring constant?
  13. science

    Assume that the hereditary information carried in genes and DNA is responsible many differences observed in humans and other living things. How could just four different bases in DNA strands be responsible for the almost endless variety found in nature?
  14. biology

    What diseases can mitochondrial DNA cause? Are they hereditary?
  15. BIOOOOO

    can somebody please explain the relationship between the structure of DNA, protein structure and the phenotype of an organism and the relationship between DNA chromatin and chromosome
  16. Science

    what does DNA stand for? What is a gene? Where in the cell are chromosomes located? what two scientists established the structure of DNA? DNA is sometimes descrived as twisted ladder. What is this shape called? What forms the backbone of DNA? What forms the rungs of the ladder...
  17. Ap Chemistry

    Two objects A and B of different size are both at a temperature of 500 K and are connected by a rod (A looks four times larger than b). What will be the nature of transmission of heat? A. Gradual transmission from B to A B. No transmission of heat will occur C. Rapid ...
  18. bio

    o What are some of the benefits of squeezing so much data into virtually every cell in the body? o Why did humans not evolve with one central repository of DNA rather than having it replicated throughout the body? o Assume that the hereditary information carried in genes and ...
  19. Biology- please help :)

    The Hershey-Chase experiment proved that DNA was the hereditary material because? A)radioactive phosphorus in viral proteins was shown not to enter bacterial cells. B)radioactive phosphorus in viral DNA was shown to enter bacterial cells. C)radioactive sulfur in viral proteins...
  20. Biology

    The Hershey-Chase experiment proved that DNA was the hereditary material because a- radioactive phosphorus in viral proteins was shown not to enter bacterial cells. b- radioactive phosphorus in viral DNA was shown to enter bacterial cells. c- radioactive sulfur in viral ...
  21. Biology

    Using RNA a s a template for prot e in synthesis instead of t r ans l a t ing prot e ins directly from the DNA is advantageous for the cell because A) RNA is much more stable than DNA. B) RNA acts as an expendable copy of the genetic material, allowing the DNA to serve as a ...
  22. science

    how does the structure of DNA help account for the way in wich DNA copies itself
  23. science

    Through which are the chromosomes, transmitted according to the path of transmission of factors from the parental generation to offspring's as indicated by Mendle? (1) hereditary chapters (2) evolution (3) heredity (4) gametes
  24. science

    Through which are the chromosomes, transmitted according to the path of transmission of factors from the parental generation to offspring's as indicated by Mendle? (1) hereditary chapters (2) evolution (3) heredity (4) gametes
  25. Science

    what is the cell's hereditary material?
  26. biology- DNA

    Explain the function and structure of DNA.
  27. Science

    Hi my textbook is not helping me at all, any links or ideas would be appreciated! What are some of the benefits of squeezing so much data into virtually every cell in the body? Why did we not evolve with one central repository of DNA rather than having it replicated throughout...
  28. biology

    Through which are the chromosomes, transmitted according to the path of transmission of factors from the parental generation to offspring's as indicated by Mendle?option are as follows (1) hereditary chapters (2) evolution (3) heredity (4) gametes
  29. Science help please!!!!!!!

    Hi my textbook is not helping me at all, any links or ideas would be appreciated! What are some of the benefits of squeezing so much data into virtually every cell in the body? Why did we not evolve with one central repository of DNA rather than having it replicated throughout...
  30. biology

    do you have basic cell structure typical plant vs animal cells organelles- stucture and function DNA DNA replication
  31. biology check answers please

    The Hershey-Chase experiment proved that DNA was the hereditary material because. a) radioactive phosphorus in viral proteins was shown not to enter bacterial cells b) radioactive phosphorus in viral DNA was shown to enter bacterial cells **** (my choice) c) radioactive sulfur...
  32. Biology Check my work please

    The Hershey-Chase experiment proved that DNA was the hereditary material because. a) radioactive phosphorus in viral proteins was shown not to enter bacterial cells b) radioactive phosphorus in viral DNA was shown to enter bacterial cells **** (my choice) c) radioactive sulfur...
  33. SCIENCE HELP PLZZZZZ! ONLY ONE QUESTION!

    Which of the following correctly describes how nerve impulses move throughout the body? A. Electrical transmission through neurons and elecrical transmission between neurons. B. Chemical transmission through neutrons and chemical transmission between neutons. C. Chemical ...
  34. SCIENCE HELP! ONLY ONE QUESTION!

    Which of the following correctly describes how nerve impulses move throughout the body? A. Electrical transmission through neurons and elecrical transmission between neurons. B. Chemical transmission through neutrons and chemical transmission between neutons. C. Chemical ...
  35. biology

    I am absolutly 100% biology stupid... I don't understand it, it is like a foriegn language to me... this is my questions. What are some of the benefits of squeezing so much data into virtually every cell in the body? · Why did humans not evolve with one central repository of ...
  36. Biology

    Do you know, by chance, how scientists discovered the make-up of DNA? Was it via a microscope and if so, what type of microscope allows you to view the structure of DNA?
  37. Science

    Bacteria, such as E coli are simple, single-celled (unicellular) organisms. Elodea, also known as water weed, is a plant that is commonly used in aquariums. Which of the following is a main difference in cell structure between an E coli and an Elodea cell? A.An Elodea cell ...
  38. Science

    Bacteria, such as E coli are simple, single-celled (unicellular) organisms. Elodea, also known as water weed, is a plant that is commonly used in aquariums. Which of the following is a main difference in cell structure between an E coli and an Elodea cell? A.An Elodea cell ...
  39. Chemistry-Just checking my answer

    For each template DNA, I prepared a second PCR reaction that includes "GMO" primers. Assume that all three foods had usable plant DNA. Which template DNA (non-GMO,GMO,test food) would you expect to show successful amplification of the "GMO" target sequence? I said all three ...
  40. Science Plzz Help

    3. Which of the following correctly describes how nerve impulses move throughout the body? A. electrical transmission through neurons and electrical transmission between neurons B. chemical transmission through neurons and chemical transmission between neurons C. chemical ...
  41. Health (Ms. Sue)

    Summarize how genes are involved in hereditary diseases. A: Genes are involved in hereditary diseases as defective genes inherited by one or both parents is one of the causes of hereditary disease?
  42. AP Biology- Molecular Genetics

    The correct sequence between genes and their phenotypic expression is a) RNA-DNA-protein-trait b) DNA-RNA-protein-trait c) Protein-DNA-RNA-trait d) trait-DNA-RNA-protein I think it is either b or d but do not know if the trait is at the beginnig or end... Once translated, the ...
  43. AP BIO

    2. Suppose the DNA molecule were composed of six monomers. In addition to the monomers A, T, C and G, two other monomers, O and P, were present. Furthermore, O and P were known to pair only with each other. Which of following statements regarding this kind of DNA molecule ...
  44. A and P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? What is its mRNA nucleotide sequence? Indicate the product of this DNA segment/gene. What is the product’s primary structure? How ...
  45. chemistry

    what chemical properties of the nitrogenous bases contribute to stability of DNA?
  46. science please help

    in evolutionary terms, RNA is thought to have preceded proteins and DNA. Which of the following observations provides the most convincing support for hypothesis? a) there are more types of RNA than there are DNA b) RNA contains combined catalytic, structural, and genetic ...
  47. Biology: Genetics

    How do nucleotides and hydrogen bonds affect the structure of DNA? Maybe something like nucleotides make up DNA and hydrogen bonds hold the nitrogenous bases together? Can you help me explain?
  48. science- cell structure

    An inner and an outer membrane are characteristic of which organelle? my answer: Mitochondria and chloroplasts What is the nucleus? my answer- nucleus is a cell structure that contains hereditary information What is the nucleiod? my answer: the nucleiod is like the nucleus. ...
  49. Biology

    How do nucleotides and hydrogen bonds affect the structure of DNA? Maybe something like nucleotides make up DNA and hydrogen bonds hold the nitrogenous bases together?
  50. Science HELP PLS

    1. What is a Genetic Mutation? A. the process of decreasing chromosome numbers to half of what the parent cell has B. the copying of DNA to form identical daughter cells C. a permanent change in an organism’s genetic code D. a fusion of egg and sperm cell to produce a new ...
  51. Biology

    In the final step of DNA extraction from E. Coli bacteria, we used ethanol so that the DNA would precipitate. Why is it that DNA precipitates in ethanol, and not in water? Both of them are polar solvents, and so is DNA. So why doesn't water make DNA precipitate?
  52. biology 2 ap

    All living organisms share all of the following features in common except A. carry out metabolism B. transfer energy with ATP C. encode hereditary information in DNA D. are composed of one or more cells E. containing organelles
  53. genetics

    Though this question sucks, which enzyme elongates the new DNA strand starting at an RNA primer? A.DNA polymerase I B.DNA polymerase III C.DNA polymerase II D.DNA ligase E.RNA polymerase
  54. A&P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? 1A. What is its mRNA nucleotide sequence? AGCCCGAUGUUUUGUUUAGUUGCCCCGAGCGUUUGUUUAUUUGCC 1B. Indicate the product of this DNA segment/...
  55. bio

    what is the structure of DNA?
  56. science

    Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A or B. A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the correct DNA ...
  57. Science-important!

    Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A or B. A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the correct DNA ...
  58. science

    Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
  59. Biology

    Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
  60. Science

    mismatch error to be repaired? Which is the best answer, I think it's A. Can someone who know's science tell me if I am right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
  61. chemistry

    What is the monomer and polymer structure of DNA?
  62. Anatomy + Physiology

    What are the building blocks for nucleic acids DNA and RNA? DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polymers of nucleotides linked in a chain through phosphodiester bonds. In biological systems, they serve as information-carrying molecules or, in the case of...
  63. Biology

    I am doing a chart on function and structure and i am stumped by this question Modified cell products must arrive to specific docking sites—where they are necessary— What structure tells the vacuole to dock where it needs to? - Would this be the nucleus, the nucleus has ...
  64. science

    Which of the following characteristics are true for both plants' and animals' reproduction? A. alternation of generation B. They carry hereditary material from parent. C. characterized by sexual reproduction D. The offspring looks identical to its parents. C?
  65. bio

    Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA is: A. Slightly ...
  66. bio

    Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA is: A. Slightly ...
  67. Biochem

    Computers English Foreign Languages Health Home Economics Math Music Physical Education Science Social Studies GRADE LEVELS Preschool Kindergarten Elementary School 1st Grade 2nd Grade 3rd Grade 4th Grade 5th Grade 6th Grade 7th Grade 8th Grade High School 9th Grade 10th Grade...
  68. science

    what two scientists established th structure of DNA?
  69. biology

    How to make structure of DNA ladder like
  70. Biology

    Which of the following statements regarding DNA and RNA is true? DNA can melt while RNA cannot. DNA is resistant to alkaline hydrolysis while RNA is not. DNA contains phosphodiester bonds while RNA does not. DNA can form double helices while RNA cannot.
  71. Science

    The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies can be be made directly from the DNA I'm pretty sure the answer is D, ...
  72. Calculus

    An open-topped cylindrical pot is to have volume 125 cm3. Determine the minimum possible amount of material used in making this pot? Neglect the thickness of the material as well as possible wastage. Give your answer accurate to 2 decimal places.
  73. calculus

    An open-topped cylindrical pot is to have volume 125 cm3. Determine the minimum possible amount of material used in making this pot? Neglect the thickness of the material as well as possible wastage. Give your answer accurate to 2 decimal places
  74. BIOLOGY

    how the structure of DNA allows it to serve as the basis for inheritance
  75. Biology-Is my answer correct

    Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...
  76. DNA

    Do the two DNA double helices following DNA replication have the same, or a different, composition?
  77. Biology

    In DNA fingerprinting, the DNA probe that is used is ______to the DNA sequence of the repeats in the sample? im guessing amplify????
  78. Science

    In DNA fingerprinting, the DNA probe that is used is ______to the DNA sequence of the repeats in the sample? im guessing amplify????
  79. Recombinant DNA

    When you digest Vibrio DNA with Sal1, wh do you get mostly large DNA fragments?
  80. Honors Biology

    What role did politics play in the discovery of the structure of DNA?
  81. Psychology

    what are four social structure factors that contribute to family problems
  82. genetics

    DNA markers, or variant non-coding regions of DNA, are DNA polymorphisms that are useful for genetic mapping. True False
  83. science

    1.Darwin assumed that evolutionary change was always slow and gradual. What was the first evidence that suggested evolution change might happen fast sometimes? A. Homologous structures B. Fossils*** C. Reproduction rates D. DNA sequences 2.Which of the following provides ...
  84. Biology/DNA

    When doing a DNA extraction, what advantages does a TE buffer provide to DNA that water cannot?
  85. Science

    Please Check! 1. How does nanotechnology help engineers make products for the future? a. By changing a materials atomic structure, it can be made from elements that are easier to obtain.*** b. By changing a material's atomic structure, its physical properties can also be ...
  86. biology

    what are three ways that DNA mutation can alter genetic material?
  87. Biology

    17. Functions of the nucleus include a. directing the function of the cell b. the partial assembly of ribosomes c. storing most of the hereditary information of the cell d. all of the above D? 18. Internal membrances play important roles in protien production and processing ...
  88. Biology

    17. Functions of the nucleus include a. directing the function of the cell b. the partial assembly of ribosomes c. storing most of the hereditary information of the cell d. all of the above D? 18. Internal membrances play important roles in protien production and processing ...
  89. Biology

    17. Functions of the nucleus include a. directing the function of the cell b. the partial assembly of ribosomes c. storing most of the hereditary information of the cell d. all of the above D? 18. Internal membrances play important roles in protien production and processing ...
  90. Science

    1. How does a mutation in the DNA affect the way proteins are made? A) a mutation in the DNA results in miss happen tRNA molecules ** B) a mutation in the DNA results in a chance in the mRNA, but it does affect the protein C) a mutation in the DNA affects the structure of mRNA...
  91. Science

    Darwin assumed that evolutionary change was always slow and gradual. What was the first evidence that suggested evolutionary change might happen fast sometimes? a. homologous structures b. fossils c. reproduction rates d. DNA sequences Which of the following provides evidence ...
  92. Biology- DNA

    What is needed to synthesize DNA? -a DNA strand -a primer and is that it?
  93. DNA

    I have to build a DNA and RNA structure. It must stand on its own. What materials would you suggest i use? Thank you. http://biology.about.com/c/ht/00/07/How_DNA_Model_Candy0962932481.htm
  94. math

    Current implementations of the ‘WiMAX’ wireless technology can support 2 Mbps connections at a distance of 10 km; calculate the propagation delay caused by the transmission time alone for a signal to travel 10 km.). Give your answer in seconds and in scientific notation ...
  95. 7th grade science Ms. Sue pleae only 1 question

    1. Gene therapy research uses _______ to alter defective hereditary material. (1 point) bacteria cells interferons viruses Is the answer viruses? Or maybe its cells?
  96. Science

    Describe how the structure of DNA is correlated with its role as the molecular basis of inheritance in Biology.
  97. Science Please Check

    Please Check 1. How does nanotechnology help engineers make products for the future? a. By changing a materials atomic structure, it can be made from elements that are easier to obtain.*** b. By changing a material's atomic structure, its physical properties can also be ...
  98. Public speaking

    Early theories of communication viewed public speaking as: A. a one-way transmission of messages. B. a two-way transmission of messages. C. only possible through a medium. D. an any which way transmission of messages.
  99. biology: genetics

    You are attempting to determine whether a plant-derived processed food sample (for example, a corn chip) contains material from a genetically-modified organism (GMO). First, you crush the sample and attempt to extract DNA from it. Next, you perform PCR using two different sets...
  100. computer science

    Current implementations of the ‘WiMAX’ wireless technology can support 2 Mbps connections at a distance of 10 km; calculate the propagation delay caused by the transmission time alone for a signal to travel 10 km.). Give your answer in seconds and in scientific notation ...
  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. 16
  18. 17
  19. 18
  20. 19
  21. 20
  22. 21
  23. 22
  24. 23
  25. 24
  26. 25
  27. 26
  28. 27
  29. 28
  30. 29
  31. 30
  32. 31
  33. 32
  34. 33
  35. 34
  36. 35
  37. 36
  38. 37
  39. 38
  40. 39
  41. 40
  42. 41
  43. 42
  44. 43
  45. 44
  46. 45
  47. 46
  48. 47
  49. 48
  50. 49
  51. 50
  52. 51
  53. 52
  54. 53
  55. 54
  56. 55
  57. 56
  58. 57
  59. 58
  60. 59
  61. 60
  62. 61
  63. 62
  64. 63
  65. 64
  66. 65
  67. 66
  68. 67
  69. 68
  70. 69
  71. 70
  72. 71
  73. 72
  74. 73
  75. 74
  76. 75
  77. 76
  78. 77
  79. 78
  80. 79
  81. 80
  82. 81
  83. 82
  84. 83
  85. 84
  86. 85
  87. 86
  88. 87
  89. 88
  90. 89
  91. 90
  92. 91
  93. 92
  94. 93