hi can you predict the next sequences possible from the numbers 1-50 05 16 20 30 41

30,784 results

math

hi can you predict the next sequences possible from the numbers 1-50 05 16 20 30 41

geometry

predict the next two numders in this sequences:-5,-2,4,13_,_

Algebra

Predict the next two numbers in this sequence. Leave a comma but no spaces between the numbers. 1/4, 1/9, 1/16, 1/25,...

math

you buy a bicycle lock with 4 dials to enter the combination. the first dial has numbers from 0 to 9, the next dial has numbers from 3 to 8, the next has numbers from 0 to 4 and the last has letters from A to Z. write the equation for the number possible combinations of the ...

math

I need to figure out the next two numbers in the following sequences. A)144, 121, 100, 81, B)3, -12, 48, -192,

geometry

predict the next two numbers in this sequence:2,6,18,54,_,_

Biology

When making comparison of sequences where some are whole genome sequences while others are partial genome sequences, or a specific glycoprotein sequence, How is it that we are able to make comparisons from these sequences if they all have different lengths?

Math

Describe a pattern in the sequence of numbers. Predict the next number. 256,16,4,2,...

Maths

From this past 4 results 17-90-48-84-41. 46-6-15-64-85. 78-41-65-50-54. 52-70-30-42-29. Can anyone predict the next 5/90 lotto winning numbers please

college mathematics

Use inductive reasoning to predict the next three numbers in the sequence. 1, 0, -2, -5, -9,

Probability

Automated chemical synthesis of DNA has made it possible to custom-order moderate length DNA sequences from commercial suppliers. Assume that a single nucleotide weighs about 5.6 X 10^-22 grams and that there are four kinds of nucleotides. If you wish to order all possible DNA...

Math

What is the sum of the first 200 odd numbers? A rectangle has an area of 120 cm square we are trying to find possible perimeters. It's length and width are whole numbers. What are all the possibilities for the 2 numbers? Give next two terms 3,4,7,11,18,29.... 1,2,6,24,120.... ...

math

Brilli the ant placed the numbers 1,2,…,n in order clockwise around a circle. She can create an infinite sequence A={aj}∞j=0 of integers by letting a0=k∈{1,2,…,n} and constructing ai+1 from ai by taking the integer that is ai positions clockwise in the circle ...

biology

Below the human hemoglobin sequence are the first thirty amino acid sequences of several other species’ hemoglobins. Inspect the sequences and answer the following questions: Human) h l t p e e k s a v t a l w g k v n v d e v g g e a l g r l A) ml t a e e k a a v t a f w g k...

Math (help steve)

Brilli the ant placed the numbers 1,2,…,n in order clockwise around a circle. She can create an infinite sequence A={aj}∞j=0 of integers by letting a0=k∈{1,2,…,n} and constructing ai+1 from ai by taking the integer that is ai positions clockwise in the circle ...

Stats

You are allowed to choose four whole numbers from 1 to 10 (including 1 and 10). You can only choose each number once though. Which of the following statements is FALSE? A. The numbers 4, 5, 6, and 7 have the smallest possible standard deviation. B. The numbers 1, 2, 3, and 4 ...

math(sequences)

0.5,1.5,4.5,13.5,... what is the next three terms??? plz help

Math

Last Week June 16,2017 Ghana's Midweek Lottery Results were as follows Win: 05-25-71-56-19 Machine: 42-57-45-36-68 Please help me predict the next winning numbers for today June 21,2017

sequences help plskthx

what are the next three terms in the sequence -3 6 15 24 35, 46, 57 34, 44, 54 33, 44, 56 33, 42, 51 i think it's d

Series and Sequences

Find the next three terms in the pattern 20,40,60,11,31,51,......

Sequences and Series

Find the next three terms in the pattern, 25,5,30,6,35,7,....

Sequences

A = {a1, a1 + d1, a1 + 2d1, …}, B = {a2, a2 + d2, a2 +2d2, …}. Investigate whether A + B and A x B are arithmetic or geometric sequences. If an arithmetic sequence is identified, state its common difference. If a geometric sequence is identified, state its common ratio. (...

Math

I'm learning series and sequences (grade 11). Please check that my steps show I understand what I'm doing/the concept and my answer as well: 5. The consecutive terms of an arithmetic sequences are 3.6, y, 8.2. Find the value of y. This seems to be a sequence question but I ...

Math

A sociology seminar has 7 members (a) They begin each meeting with each member shaking hands with all the other members. No one shakes another member's hand twice. How many handshakes take place? (b)The professor shakes hands with each member of the seminar and in a different ...

MATH!!!! SEQUENCES!!!

Find out a formula for the Nth term of each of the following sequences. (i)4 7 10 13 16 (ii)1 3 5 7 9 (iii)20 17 14 11 8 (iv)1 4 9 16 25 (v)2 8 18 32 50

MATH

How many six-letter sequences are possible that use the letters c, i, c, c, i, y?

algebra

For each of the following sequences, find an explicit and a recursive description of the pattern. Assume sequences start from n = 1. a. 1, -1, -3, -5... b. 8,2,3,9... c. -2, 0, 0, -2, -6...

Math (Combinatorics)

A lottery ball drawing machine has 50 balls, each labeled with a distinct integer from 1 to 50. Every Sunday, four different balls are drawn to determine the winning numbers. You have last Sunday's ticket with the numbers {3,7,12,15}. You missed the drawing, but heard that 15 ...

math

How many five-letter sequences are possible that use the letters a, p, j, e, x once each?

math

What is the pattern to this sequence? 1,3,4,7,11,18,29 I figured it was plus the last 2 numbers which will then equal the next number. But I got messed up and can't figure the next 3 numbers in this pattern, any help is helpful. THanks

Math

One number is 10 less than twice a second number. Find a pair of such numbers so that their product is as small as possible. These two numbers are_ and _. (Use a comma to separate your numbers.) The smallest possible product is_. The number are NOT 5,15 or 15 and 5

Math

Can you help me find the next 2 terms in the sequences? 1, .025, .1 repeating, .0625,.04 2root2, 4, 4root3, 8root3, 8root15, 24root10

math (data management)

How many n-digit decimal sequences (using digits 0-9) are there with k 1s? I'm not entirely sure what you question is asking, but I'll take a guess. You have n digits and k 1's with k<n There are n choose k ways to arrange the 1's in your number. You now have n-k places to ...

MATH

the numbers below are Fibonacci numbers. 1,1,2,3,5,8,13,21,34,55,... write a rule for the pattern. what are the next three numbers?

math

Consider the following sums of numbers and how they are formed: 1 odd number } 2 odd numbers 678 3 odd numbers 64748 Predict the following sum and complete the generalization: a. 1 + 3 + 5 + 7 + 9 + 11 = ? b. 1 + 3 + 5 + Á + (2n - 1) = ?

geometric sequences

given the geometric sequences:9 90/17, 900/289 find an explicit formula for an, where the first term is a1=9 an= a10=

math

Terms of sequences 15,22,31,42,55 find next 3 terms and the formula also for the sequence

Biology Help Please!

)Describe the importance of chromatin remodeling process to transcription. Select the four correct answers. a) These alterations can be used to activate transcription of a gene by hiding its enhancer sequences. b) These alterations can be used to activate transcription of a ...

6th grade math

Is there a quick way to get the answer to this problem without doing a calculation of each possible answer. These numbers are arranged from greatest to least. Which value is next. F) 1/2 G) 0.58 H) 6/8 J) 0.65

Maths: Sequences need help

The nth term of a sequences of v1,v2,v3 is given by Vn=6 2^n (1):show that for all value of n>1 Vn1=2(Vn-3)?? (2): obtain and simplify the sum of the first n term of the sequence??

Maths

For this question, use the copy of the Random Number table provided at the end of this AAT. (This table was copied from page 111 in the Textbook.) Select 48 values according to the following criteria. o The first thirty (30) numbers must lie in the range from 48 to 58 ...

Biology

Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5: GCCAAGGCACTACGCTACGTCGCATTATAC ...

Math

Use inductive reasoning to predict the next number in the sequence. Describe the pattern. 0, 3, 3, 0, -3, . . . I know the next number would be -3, But what is the pattern called?

probability

you are to set up a code of consisting of three letters (A to Z) and five numbers (0 to 9). a) how many codes are possible if the letters and numbers can be repeated? b) how many codes are possible if each letter and digit can be only used once? c) how many codes are possible ...

Math

your class is conducting an experiment to study geometric sequences. The class forms a line. the first person takes a whole pizza,divides it in half, keeps half, and hands it to the next person. The next people in line do the same with there peices. Which portion does the ...

Maths A

Select 48 values according to the following criteria. o The first thirty (30) numbers must lie in the range from 48 to 58 inclusive. o The next ten (10) numbers must lie in the range from 30 to 70 inclusive. o The remaining eight (8) numbers must lie in the range from 50 to 95...

math

determine the next three numbers in this pattern: 2,3,5,7,11,13,17,19,23,___,___,___ Aren't these all prime numbers? Find the next three numbers in the pattern. 5,2,-1,-4 3,2,0,-3,-7 -8,-6,-2,4,12 -5,-7,-8,-10,-11

English

Hello. I'll be grateful for your help. 1)Is it possible to say "next day" instead of "tomorrow", for example: "I'm meeting with him next day."? 2)Is it possible to use "develop" in the meaning "explain", for example:"He will develop the situation later."? Thank you very much ...

math

Ture or false questions: Your teacher gives a true-false pop quiz with 10 questions. Show that the number of possible outcomes for the sample space of possible sequences of 10 answers is 1024. I got false and the number is 182 but don't think I have the right number. Some help...

Biology

Humans and Gorillas are very similar in terms of their genetic sequences; in a sample of each of their DNA sequences, only ONE difference was found. MY QUESTION: What genetic mechanism could cause this base sequence change? Thanks!

College Chemistry

How many orbitals have the following quantum numbers: n=6, l=2, ml=-2?? a. 0, b. 5, c. 7, d. 10, e.6 Since only one can include n=6 in its equation would it make it just one orbital having those numbers? im also thinking that there might be other orbitals that have these ...

English

Hello. I'm very grateful for your help and will appreciate some more. 1)Are the sentences correct: a}The team is conducting an experiment next week. b)The team will be conducting an experiment next week. c)He is giving a lecture at 5 next Monday. d)He will be giving a lecture ...

Series and sequences

Three numbers a,b, and c form a geometric series so that a+b+c=35 and abc=1000. Find the values of a,b,c.

Maths Please Help

Let A=a1,a2,…,ak and B=b1,b2,…,bj be sequences of positive integers such that a1≥a2≥⋯ak≥1, b1≥b2≥⋯bj≥1, ∑i=1k ai≤6, and ∑j i=1 bi≤6. For how many ordered pairs of sequences (A,B) satisfying the above ...

math

108 ,36,12,4 ___ ,____find next two numbers 12,24 ,48,96 ____, ___ find the next two numbers 1 ,1,2,3 ____, ____ find the next two numbers

finding numbers

The sum of two positive numbers is 20. Find the numbers if the sum of their squares is as large as possible; as small as possible. What does it mean? This is from applications of derivatives. How do I solve this. Two numbers, x, and 20-x Sumsquares= x^2 + (20-x)^2 is max. Take...

math

How many different sequences of 4 digits are possible if the first digit must be 3, 4, or 5 and if the sequence may not end in 000? Repetition of digits is allowed

math

how many different sequences of 4 digits possible if the first digit must be 3,4 or 5 and if the sequence may not end in 000? repetition of digits is allowed.

Geometry

How many different sequences of 4 digits are possible if the first digit must be 3, 4, or 5 and if the sequence may not end in 000? Repetition of digits is allowed.

Math

1,6,3,7,9,4,5,7=17 only plus or minus can be out in between the numbers and they must stay in the order shown EX. 1-6+3-7+9-4+5+7=17 It must equal 17 Here's a hint. Add all the numbers up first, then see what number needs to be subtracted in order to get 17. Then find a ...

statistics

A daily lottery is conducted in which two winning numbers are selected out of 100 numbers. How many different combinations of winning numbers are possible?

geometry

predict the next two numder in this sequence: 1,4,16,64_,_

12th Calculus

the sum of two nonnegative numbers is 20. find the number if a. the sum of their squares is as large as possible; as small as possible b. oen number plus the square root of th eother is as large as possible; as samll as possible

Statistics

A volunteer ambulance service handles 0 to 5 service calls on any given day. The probability distribution for the number of service calls is as follows: one column has number of service calls (X) those numbers are 0 1 2 3 4 5. The next column Probability P (X) those numbers ...

Math

Six whole numbers have A median of 10 A mode of 11 A range of 4 Work out a possible set of a six numbers. Write the numbers in order. Thank you.

math

How many n-digit decimal sequences (using digits 0-9) are there with k 1s? Decimal sequences meaning you can have as many 0s in front of a number. For example: 000001234557891111 would be consider valid. So how do i come up with an equation? See my response to Sana's question ...

math

Danielle has 4 hundreds,3 tens, and 6 ones blocks. Identify the greatest and the least possible 3-digit numbers she could subtract from that number. Then give the greatestand least possible 2-digit numbers she could subtract.

Math

Can you subtract two negative numbers and get a positive difference? What are some examples, if it's possible? Can you add two negative numbers and get a positive sum? (I fairly certain it's not possible, but I'm not sure how to explain why it's not...)

masterin quantum

Consider the left shift operator on the space of infinite sequences of complex numbers: L(z1,z2,…)=(z2,z3,…). Is L injective? Yes <text> Yes</text> - incorrect No Is L surjective? Yes <text> Yes</text> - correct No Find the eigenvalues and ...

Integers

Suppose a1, a2, . . . , an is a list of n numbers with the following properties: The sum of those n numbers is 500. The sum of the smallest three of those numbers is 48. The sum of the largest two of those numbers is 35. (Note: There might be some repetitions among the numbers...

Math

Predict the numbers in the sixth role. 1.)1 2.)1,1 3.)1,2,1 4.)1,3,3,1 5.)1,4,6,4,1 6.)?

geometry

HELP.... In a certain lottery, 3 numbers between 1 and 9 inclusive are drawn. These are the winning numbers. How many different selections are possible? Assume the order in which the numbers are drawn is not important. Answer choice: a.) 6 b) 84 c) 504 d) 729

math

How many different sequences of 4 digits are possible if the first digit must be 3, 4, or 5 and if the sequence may not end in 000? Repetition of digits is allowed. A) 2000 B) 2997 C) 2999 D) 1512

maths

if 59,51,76,3,6 were numbers as total and 84,88,35,62,18 were machine produce what will be the next 5 out come numbers.if we are selecting from 1 to 90.

math

Use inductive reasoning to predict the next number in the sequence. 4) 1, -1/4, 1/16, -1/64, 1/256, . .

algebra

Use inductive reasoning to predict the next complete line in the pattern. 10 × 12 = 11 × 13 - 23 12 × 14 = 13 × 15 - 27 14 × 16 = 15 × 17 - 31

math

12,48,63,30,25 are set of numbers,what will be the next five numbers,please help

math

what will be the next five numbers of the following set of numbers 12,48,63,30,25.thank u

math

if 18,38,14,6,53 were selected from 1-90 next selection numbers will be what five numbers

Math

Change the base five numbers to equivalent base ten numbers. Also take given base five numbers and write next five base numbers to five numbers. a. 23 five b.14 five c. 214 five

Math

I have to find the relationship between these sequences, and express a generality. Could you help please. 1 + 3 + 5 + 3 + 1 = 3^2 + 2^2 1 + 3 + 5 + 7 + 9 + 7 + 5+ 3 + 1 = 5^2 + 4^2 1 + 3 + 1 = 2^2 + 1^2 I'm thinking sum of consecutive primes can be expressed in squares? The ...

Problem Solving: Writing to Explain

Look at the numbers 13, 15, 19, 25,.... Describe the pattern and how can you find the next tow numbers.

Math

The average of the first 4 numbers is 14. The average of the next 6 numbers is 25. What is the average of all 10 numbers. Can you explain how to calculate this please.

stats 1040

you play a game in which you win $4 if you correctly predict the numbers of spots on a fair 6-sided die and you lose $1 if you don't correctly predict the number of spots. you plan to play 100 times. how do you set up a box model to represent your net winnings assuming you ...

ALGEBRA I

can anybody help me find the pattern in these two sequences please!! I can find the next two terms after that myself. I have spent at least 30 minutes on each and I can't figure it out...help!! 1)1, 1/4, 1/9, 1/16, 1/25,.... 2)1, 1/2, 1/3, 1/4,....

Maths A

For this question, use the copy of the Random Number table provided at the end of this AAT. (This table was copied from page 111 in the Textbook.) Select 48 values according to the following criteria. o The first thirty (30) numbers must lie in the range from 48 to 58 ...

contempory math

use inductive reasoning to predict the next three number in the patterns 3,4,7,11,18,29

science

Of all possible DNA nucleotide sequences, what sequence of base pairs would dissociate most easily into single strands if the DNA duplex were heated gently?

Maths

Consider all 3-term geometric sequences with first term 1 and with common ratio the square of an integer between 1 and 1000. How many of these 1000 geometric sequences have the property that the sum of the 3 terms is prime?

algebra

Consider all 3-term geometric sequences with first term 1 and with common ratio the square of an integer between 1 and 1000. How many of these 1000 geometric sequences have the property that the sum of the 3 terms is prime?

math

how many possible 3 digit numbers are there that have a middle zero? how many possible 4 digit numbers are there that have two middle zeros? Explain your answears

Algebra1

45. Find your percent correct on a test if you received 61 points out of 69 possible. 88.4% 49. Find your percent on a test if you received 42 points out of 80 possible. 52.5% 50. Scientific notation is most effective when used with _____ a. very small numbers b. very large ...

Astronomy

Venus is 0.72 AU from the Sun and Neptune is 30.06 AU from the Sun. Both have similar orbital eccentricities, 0.7 and 1.0 respectively. Predict how long it will take Venus to make one revolution around the sun compared to Neptune. Also predict the orbital speed of Venus and ...

Math

Consider all 3-term geometric sequences with first term 1 and with common ratio the square of an integer between 1 and 1000 (inclusive). How many of these 1000 geometric sequences have the property that the sum of the 3 terms is prime?

Math

Using only the digits 2,3,5 and 7 complete the following problems below. 1.Name two things that the numbers 2,3,5,7 have in common 1.All prime numbers 2.What is the smallest possible number that can be written using each of these digits only once? 2357? 3.Using the 7 in the ...

chemistry

Quantum numbers arise naturally from the mathematics used to describe the possible states of an electron in an atom. The four quantum numbers, the principal quantum number (n), the angular momentum quantum number (ℓ), the magnetic quantum number (mℓ), and the spin quantum ...

Chemistry

How to predict the possible structures of a compound if the degree of unsaturation of it is in fraction?

math

1. Examine the first four terms in each of the following number sequences: *2, 7, 12, 17 my formula x+5 *7, 21, 63, 189, 567 my formula x(2)+x *1000, 850, 700, 550 my formula x-150 * –10, –6, –2, 2 my formula x+4 For each sequence, what would be the 20th and 100th term? ...

Math

what is the next number in the following series of numbers? 100 96 104 88 120 56? Let's look at the pattern of these numbers. 100 - 4 = 96 96 + 8 = 104 104 - 16 = 88 88 + 32 = 120 120 - 64 = 56 What do you think the next number is? Please post your answer and we'll check it ...

math

The sum of two numbers is 16 . What is the largest possible product between these numbers

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92
  93. 93
  94. 94
  95. 95
  96. 96
  97. 97
  98. 98
  99. 99
  100. 100