
6,895 results


I have a quiz on genetics on friday in AP Biology and I would like some sites with good ap biology questions on them. I don't know any of them which I could go to.

Biology 101

How are meiosis and genetics related?


how does the urinary system support reproduction and passing on genetics?

biology - genetics

is the cis-regulatory sequence found in the exome?

Biology - genetics

How does crossing over change the combination of alleles in gametes? Thanks :)

Biology -Genetics

True or False X and Y chromosomes are found only in eggs and sperm. T or F ?

Biology quick please

I need a practice biology test to practice for my final exam which is tomorrow. I'm a tenth grader and the things we learned were mitosis, meiosis, production of gametes, human reproduction, cell devision, mendelian genetics, probablitity of inheriting traits, dna, and what ...

Biology 101

Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.

Biology 101

Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.


In reference to plant and animal adaptations, how are the principles of heredity and genetics applicable to how organisms change over time?

Biology - Genetics

If genes a, b, c, and d are genetically linked to each other, does it follow that a recombination experiment would detect genetic linkage between a and d?


studying genetics in mammals where can i find out about felines and canines that are proven mainly allergen free, thought not genetically modified?


The lifespan of plants varies depending on genetics and survival strategies. Discuss the adaptive value of annual, biennial, and perennial life spans.

7th G science

What is/are the main factor(s) that determine(s) the height of a plant (genetics, environment, or both)? Explain your answer. I think that only genetics play a role but I am not sure.


How does the circulatory system and the lymphatic system support reproduction and passing along genetics?


What are the key characteristics of a model organism? Name atleast 3 different model organisms used in genetics.


A 50 year old male who is not overweight and has normal blood cholesterol levels suffers a heart attack. Propose a possible explanation i think the answer would be genetics...

Criminal Justice

Discuss the merits of the idea that genetics are a source for criminal behavior. Make sure to provide examples that can be found through research studies and have evidence linking genetics and crime, including twin studies, adoption studies, and testosterone studies. What are ...


I need help finding a scientific journal on either one of these topics and talk about science environment technology and society, how this research contributed. -Genetics -Plants -Evolution -Diversity


how does the existence of cells, organelles, cellular reproduction, natural selection, DNA replication, transcription, translation, heredity, genetics, mutations, and taxonomy provide evidence that supports the theory of evolution?


Recombination frequencies a. arise from completely random genetic exchange. b. are the same for all genes. c. decrease with distance. d. are the same for cis and trans heterozygotes.


Are an organism's characteristics determined only by its genes? Explain. Yes, an organism's characteristics are determined only by It's genes becuase the parents give their offspring genes which determines their characteristics. Is my answer correct? Do I need to expand on ...

Please Help Me :( Science: Biology, Genetics!

Please help me with science genetics questions? Thanks to all who answer!! :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is called _____________...


I am having trouble wording this question. Describe the differences in the outcomes for a dihybrid cross ifgenes are: a. completely linked b. completely unlinked c. incompletely linked.

Biology: Genetics

18.Which of these is true of meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is C. the right aswer?


So I am completely confused. I am in the process of taking a quiz and the question says "a factor that seems to disappear" my options are punnet square, heredity, dominant factor, recessive factor, alleles, or genetics??? Help please? Thanks

Biology - Genetics

I have not been able to find any more in depth websites/answers for this question. DNA is considered to be a relatively stable molecule. What is it that gives the molecule its stability when the hydrogen bonds between the nitrogen bases are so easily broken?

biology - genetics

how do you compare the reversibility of point mutations and microsatellites? I thought point mutations could reverse but microsatellites can't but idk the reason.

biology genetics

In Leghorn chickens, + stands for colored feathers and C represents white feathers. At an independently inherited gene, the allele + inhibits color expression, whereas I has no effect on color expression

Biology: Genetics

18.Which of these is trueof meiosis? A. n → 2n B. n → n C. 2n → n D. 2n → 2n Is it C.?

science, biology

1. What is/are the main factor(s) that determine(s) that your plants will grow into bean plants (or other fast-growing plants that you used for your experiment) and not some other type of plant (genetics, environment, or both)? Explain your answer.

Genetics biology

A man and his wife both have normal vision, but a daughter who has color blindness can the man sue his wife for infidelity? show the cross help me please, have been lots of people saying no and yes to this


What kind of inheritance is it when the offspring have spots of different colors from its parents? Like a brown dog with a white dog makes a white/brown spotted dog.

Biology: Genetics

How do nucleotides and hydrogen bonds affect the structure of DNA? Maybe something like nucleotides make up DNA and hydrogen bonds hold the nitrogenous bases together? Can you help me explain?


All of the following important concepts of population genetics are due to random events or chance except mutation natural selection the bottleneck effect the founder effect sexual recombination I am pretty sure that the answer would be "natural selection", but I wanted a ...


The FritzHugh-Nagomo equation occurs in many apps such as biology, genetics and heat transfer. In the 1-D case, it can be written as du/dt = d^2/dx^2 + u(u-1)(λ-u) where λ is constant. Show that this eqn supports a travelling wave u(x,t) =(Ae^n1 + λBe^n2)/(Ae^n1...


A horse breeder has a black horse named Luca and he isn't certain about the horse's genetics. A purebred horse will be worth much more than a hybrid horse so he compiled all the information about the Luca and Luca's parents before approaching you. - Black is the dominate color...


1. He is absorbed in biology. 2. He is very interested in biology. 3. He is into biology. ----------------- Are they all the same in meaning?

biology, genetics

Suppose that r, red, and sc, scarlet, are two recessive eye-color mutations that lie 20 map units apart on the Drosophila X chromosome, and that each causes a red eye color in place of the wild type purple color. A. If a female from pure-breeding rr stock is mated with a red-...


A homozygous pea plant with round peas and yellow cotyledons was crossed to a wrinkled, green plant. The F1 was selfed and produced: 193 round, yellow 69 round, green 64 wrinkled, yellow 26 wrinkled, green a) propose hypothesis that allows you to calculate expected values ...

Biology (genetics)

The RAS protein acquires a mutation that prevents release of GTP. Which of the following characteristics are these cells likely to acquire? a)Self-sufficiency in growth signals b) insensitivity to anti growth signals c) angiogenesis d) metastasis e) blocking apoptosis I ...

biology / CELEISTINE

describe the genetics of the huntigton disease a. what chromosomes are affected? b. is it a result on translocation/ c. is it a sex-linked? d. does it skip a generation 3. waht are the cause of huntington disaese? how does it occur ? is it preventable ? how ? 4. waht are the ...


Is 9th grade biology hard? Is it interesting...?? I love life science but I just wondering if 9th grade biology hard??? I'm taking biology next year.

Biology - Genetics

What is the expected genotypes and phenotypes of F1 flies in the cross between virgin brown eyed female with scarlet males (genes for brown and scarlet eyes are on different autosomes)? I know that brown eyes and scarlet eyes are both recessive but I'm not sure what he ...


The allostery of an enzyme governor is likely to take two forms.They are? and regulatory B. rigid and flexible c. active and passive e. regulatory and relaxed


What is Genetics?


need help with these genetics problems. please help with what you can. thanks: Given that loci A and B in Drosophila are sex-linked and 20 map units apart, what phenotypic frequencies would you expect in male and female offspring resulting from the following crosses? (Assume A...


Can anyone comment as to wether this solution is correct for this question please !! Draw a mating diagram where L is the dominant gene for the digestion of lactose and shows the crosses between two heterozygotes and wiht the the phenotypic and genotypic ratio of the offspring...

ART Check

How would a visual effects designer working on an animated movie with human characters best use knowledge of biology? Knowledge of biology can help the designer to create accurate human features.**** Knowledge of biology can help the designer to create an action packed film ...

Genetics/biology Advice

Can anyone comment as to wether this solution is correct for this question please !! Draw a mating diagram where L is the dominant gene for the digestion of lactose and shows the crosses between two heterozygotes and wiht the the phenotypic and genotypic ratio of the offspring...

Science Fair

I'm doing my science fair project on like how healthy and junk food affect the human body. I check on the site (Rockland Sit Fair) and reading the Project Categories. Does these project categories below relates to my project??? Medicine and Health: Study of diseases and health...

Enriched science

What is the goal of synthetic biology? A. The goal of synthetic biology is to mimic living cells B. The goal of Synthetic biology is to generate new tissues to replace damage tissues C. The goal of synthetic biology is to engineer living cells to perform specific functions D. ...


Whats a homolog?


Relation b/w genetics and gp


How are the structures in genetics related?

AP Biology- Molecular Genetics

The correct sequence between genes and their phenotypic expression is a) RNA-DNA-protein-trait b) DNA-RNA-protein-trait c) Protein-DNA-RNA-trait d) trait-DNA-RNA-protein I think it is either b or d but do not know if the trait is at the beginnig or end... Once translated, the ...


why are karyotypes important tools for genetics?


What is the function of a eukaryotic promoter sequence?

science (ASAP)

what does the notation TT mean to genetics


CAN SOMEONE REVIEW MY ANSWERS AND TELL ME IF THIS IS CORRECT? Why is it flawed to ask how much of a particular behavior is due to genetics and how much is due to experience? It is inconsistent to think that behaviors are solely due to our genetic make-up. When it comes to our ...

Biology "Genetics"

Red-green Color Blindness and Hemophilia A are both sex-linked traits in humans. Both genes are on the X-chromosome and are tightly linked. Consider the pedigree below. Individual 1 is homozygous normal. Individual 2 is both red-green color blind and a hemophiliac. Individual ...

Science, Genetics

Please help me with science genetics questions? Thanks to all who answer. :) 1. Chromosome pairs contain different versions of genes, which are called ________. 2. The process in which body cells are duplicated in order to grow and repair body tissues is called _____________. ...


What is a result of scientific research in the field of genetics


Why is DNA replication termed semi conservative?

biology tutor on jiskha

i post my biology questions here today and few days ago no teacher reply. there not any biology tutor on here?

Biology - Genetics

Please help me!!!! I need help with this practice test question. In Guinea pigs, the brown coat (B) is a dominant over the cream-coloured coat (b), and straight hair (H) is dominant over curly hair (h). Using a Punnett square, complete the cross between a heterozygous brown, ...


Could you please check scientific English in this short dissertation? Thank you, Ms. Sue. 1) Conrad Waddington introduced the term epigenetics in the early 1940s. He defined epigenetics as ‘‘the branch of biology which studies the causal interactions between genes and ...


I am looking for my study guide - what ends translation ( genetics)

6th grade genetics

transferring a gene from one organism to another


Can chromosome instability cause an individual to be highly susceptible to cancer?


Can you help me determine the phenotype and proportions expected from these crosses in chickens? a) RR Pp x rr Pp b) rr PP x Rr Pp c) Rr Pp x Rr pp

early childhood

evolutionary psychology and behavior genetics: watson


what is the chance of a woman having five female children in a row?

human Genetics

In a mouse cell at the start of mitosis, how many chromatids are present?


In general, what two methods are used to grow bacteria in the laboratory?


if there are two forms of each of the seven traits, how many possible combinations are there?


What kinds of amino acids on histone tails are able to be phosphorylated and why?


why are there not many clinical studies done on rare diseases such as Batten disease?


What would happen during DNA replication if there were no thymine nucleotides available?

7th grade science

Why was Gregor Mendel given the title "The Father Of Genetics" ?


The following DNA segment has one ORF. Do you know what it codes for? 5'-TAGGATGTTCGACATGTAAGCTT ATCCTACAAGCTGTACATTCGAA

biology: genetics

You are attempting to determine whether a plant-derived processed food sample (for example, a corn chip) contains material from a genetically-modified organism (GMO). First, you crush the sample and attempt to extract DNA from it. Next, you perform PCR using two different sets...

quick science question

What are some ways in which genetics collect samples to test for disorders?

7th grade science

name two scientest who studied inherited genetics and what they used for research and why


What is an approximate value of the length of a 30 nm fiber that contains 120,000 nucleotide pairs of DNA?

BIO 101

Summarize the inheritance of sex-linked traits through meiosis and how it relates to genetics.


Is there any biology websites for teens??? (NOT games! notes and quizzes to practice). The Science of Biology The Chemistry of Life Cell Structure and Function Photosynthesis & Respiration Something REALLY easy to understand(btw I'm going to the 9TH GRADE). please help (having...


tribbles were fictional animals featured in a certain , now ancient ,science fiction television series. Lets say that tribbles have an X-Y sex determination mechanosm like that of humans. the trait bald (Xb) is X-linked and recessive to furry (Xb+), and the trait long legged (...

bio : fundamentals of genetics

A 3:1 ratio of tall to short plants in the F2 generation lends support to the principle of ________________.


Does anyone know a good website that covers aspects of human genetics? If so can i have the link and a summary of the site's content. thank you


what factor can influence obesity? A. genetics B. hormones C. environment D. all of the above my best answer is D is that correct

Sta 112

This is my question every one . Please help me have it already I had 6 as my answer. In a class of 50 student 28,22,20 of them offer physics,chemistry and biology respectively also 4 of them offer physics and chemistry but not biology,3 offer physics and biology but not ...


Hi there! I have this question for my bio/genetics homework, and I can't seem to figure it out. It reads, "A true-breeding red snapdragon is crossed to a true-breeding white snapdragon. The F1 progeny are all red. When the F1 is selfed, the following F2 progeny are observed: ...

Biology: Genetics

In guinea pig, short hair (L) is dominant to long hair (l) and the heterozygous condition for yellow coat (Y) and white coat (y) gives cream coat. A short haired guinea pig is bred to long haired white guinea pig and one of the offspring is a long haired baby guinea pig. a. ...


In guinea pig, short hair (L) is dominant to long hair (l) and the heterozygous condition for yellow coat (Y) and white coat (y) gives cream coat. A short haired guinea pig is bred to long haired white guinea pig and one of the offspring is a long haired baby guinea pig. a. ...


How could i understand the biology? can u please give me some reference to look for that.. tnx...


when might you use the "poor-quality website" in an academic Assignment in Biology?


Name three ways that the science of biology has/does, or might impact you as an individual.


i did biology post yesterday i not find it someone please tell me where it go?


ap biology lab -what barriers might hinder the acquisition of plasmids


  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69