for my comparison essay i am analysis of the 2nd device for katy perry song fireworks.. i need help explaining this line into details. could somebody give me like at least 1-2 sentence explaining it. the device im using is

112,882 results, page 46

  1. Music Theory

    I need help identifying the meter of each song (which I am having a hard time identifying them) below as Duple, Triple, Quadruple, or Quintuple Meter. Note: I did listened to the songs. 1. War - "Low Rider" 2. Hugh Masekela - "Grazin' in the Grass" 3. Dave Brubeck - "Take Five...
  2. Social Studies

    Hi. I ahave this assignment for social studies ] Here is the assignment WHERE I LIVE USING THE FIVE THEMES OF GEOGRPAHY PROJECT DUE: MONDAY, OCTOBER 3, 2011 TASK: Your family and friends want to come to your town. Use the 5 themes of geography to describe your town to them. ...
  3. Math

    1.Find the distance between P(7, -4) and the line with equation x - 3y + 5 = 0 round to nearest tenth 3Y=x+5 y=(x+5)/3 -1/m = -3 y=-3x+b sub in P(7,-4) -4=-3(7)+b b=21-4 b=17 y=-3x+17 set the two equations equal. -3x+17=(x+5)/3 -9x+51=x+5 46=10x x=4.6 sub back in: y= -3(4.6)+...
  4. calculus

    At an Oregon fiber-manufacturing facility, an analyst estimates that the weekly number of pounds of acetate fibers that can be produced is given by the function : 2 2 3 ( , ) 1250ln( ) 45( )( 2 ) z f x y yx y x x y xy       where...
  5. All core classes.

    What were some 80's icons? I have a project that's on the most important political and environmental events in the U.S during the 80's. I want to make some titles, for each subject (i had an assignment for almost each class, excluding my elective and p.e), and I'm not sure ...
  6. effective essay writing

    to develope an essay what is time order, time space and informative process?
  7. Effective Essay Writing

    I am writing an essay on Heathful Eating. Does anyone know any good sites to for me do use for research
  8. 5th grade essay of part of plants

    writting outline for 3 paragraph of an essay of part of flower
  9. Essay

    I am writing an essay and want to know, how many years do we spend in school? Starting from kindergarten to the end of high school.
  10. Writing

    How can I start my introduction for a essay ? In my essay I'll be writing about what are the benefits of being a young entrepreneur?
  11. English

    I urgently need you to check this part for me. Thank you very much for your cooperation. 1) I go on the internet every day to conduct research on various school subjects. I normally go on google as a search engine to find answers to my homework. 2) I usually spend two hours on...
  12. social studies

    according to the preamble of the constitution, give at least three reasons why the new constitution is being established?
  13. Biology Help Please!

    1) You are going to make 1800ml of a 25uM solution using a compound whose MW= 60.06 Daltons. How many grams do you need of this compound? Give your answer with four decimal places. 2) You are going to make 300ml of a 75mM solution using a compound whose MW=818 g/mole. How many...
  14. Chemistry Help Please!

    1) You are going to make 1800ml of a 25uM solution using a compound whose MW= 60.06 Daltons. How many grams do you need of this compound? Give your answer with four decimal places. 2) You are going to make 300ml of a 75mM solution using a compound whose MW=818 g/mole. How many...
  15. electronics

    which of the following statements is a true statement concerning the T-N theorem? #1-the T-N theorem can be applied only to d-c circuit analysis. #2-the T-n theorem can be applied only to a-c circuit analysis #3-the T-N theorem can be applied to circuits containing both d-c ...
  16. Science

    good day! can you please give me the wave explanation for colors? i need it for my report tomorrow. i need an immediate answer please!
  17. 6th grade science

    I know how to do the expiriment but I need help with the essay this about the glass cup over the candle and it sucks water.this is what I've got"When you put a cup on top of a lit up candle warm air gets trapped under the glass. Once the glass cools it contracts, drawing the ...
  18. Spanish

    What are least two different ways you can ask what you or someone is like in Spanish?
  19. Grammar/Langauge arts

    Hi, so I am writing an essay and couldn't figure out in the sentence below I should use affect or effect. If anyone could help I would appreciate it :). This includes the objectives of the sports, what the environments are like, and the effect the sport has on your health.
  20. History/Social Studies

    Hi, can I please have a link? I don't like cheating on essay questions. Thanks!! What are the causes of problems the Mayas and other Native American groups face in Guatemala? How are people trying to solve these problems?
  21. Algebra ??

    What would be the missing piece of information given the following information: Find the equation of the line that passes through the points (2, 6) and (4, 10). y = 2x + ? a. 4 b. 2 c. 7 d. 5 OK. let's take this step by step. y = 2x + ? Remember the equation of a line is y = ...
  22. LA a book summary help

    i need to do a book summary about the last apprentice. but i don't know what to write.i am like lost right now while trying to figure out what to write.i need a short summary. its due tommorow. and i need it done by 10 tonight.i forgot the important things that happen in the ...
  23. English

    1. Which of the following is a specific word as opposed to a general word? A. Job B. Occupation C. Physician*** D. Profession 2. Choose the topic that best limits the broad subject music. A. Famous pianist B. Modern rap music C. History of the harmonica D. History of the star ...
  24. Classical Mechanics

    During a track event two runners, Mary, and Alice, round the last turn and head into the final stretch with Mary a distance d = 2.0 m in front of Alice. They are both running with the same speed of v0= 5.0 m/s. When the finish line is a distance L= 45.0 m away from Alice, ...
  25. Writing

    The essay below is an expository essay and was written in 15 minutes. Please give me some feedback on my essay ( a score of 1 being the lowest and a score of 5 being the highest). Prompt: Explore how obesity affects a nation's productivity and economy. My essay: Americans are ...
  26. Chemistry-help needed

    Can we use an AR grade chemical for UV spectrometric analysis? Or is it a must to use a chemical that is specially designated (SpectrAR grade) for UV analysis?
  27. Chemistry-pls help

    Can we use an AR grade chemical for UV spectrophotometric analysis? Or is it a must to use a chemical that is specially designated (SpectrAR grade) for UV analysis?
  28. Calculus

    Use normal vectors to determine the intersection, if any, for each of the following groups of three planes. Give a geometric interpretation in each case and the number of solutions for the corresponding linear system of equations. If the planes intersect in a line, determine a...
  29. Statistics

    A breathalyser test is used by police in an area to determine whether a driver has an excess of alcohol in their blood. The device is not totally reliable: 7 % of drivers who have not consumed an excess of alcohol give a reading from the breathalyser as being above the legal ...
  30. biology/science

    i am doing a paper and i need to find the pros to embryonic stem cells I only have one reason which is medical but I need 4 more. Can anyone give me general ideas of pro arguments
  31. Law

    Hi there! I have totally got to find out how the Aussie Law is similar to the US law. Anyway I DO like know that like Oz follows England law mainly but that isn't what I need. Bushells of Thanks Minnie
  32. Biology

    I'm making a picture book and I need to draw the following, what would they look like? Pepsin Bile Trypsin What I'm asking is what do the following look like. Is it a solid or a liquid and what color. Thanks.
  33. math

    I have a graph that shows a ---- kind of 3 line above the solid line for x & y. My assignment is as follows. Whe have graphed the boundary line for the liear inequality. Determine the correct half-plane. y >3 First how do I solve and 2 how do I graph it? If the allowed area...
  34. crime

    Since 1991, trends seem to indicate improvement with factors involving teenagers in the United States which could translate into a reduction in juvenile crime. Provide an explanation of at least three factors that would support this belief or provide an explanation of at least...
  35. biology

    The sequence below begins with the initiator methione. ATGTTCAATGTTATGGATTGGCCCTGGTAAATGAAATAGAATGAT Please give a hypothetical (translation of cDNA sequence into single amino acid codes if there is a C deletion in the phenylalanine codon _4pts.(Please give a hypothetical ...
  36. Statisitcs

    I have given you the information from 2-4 in hopes to help with the answer for #6.. Thank you! 2. Calculate the mean and standard deviation of the probability distribution created by rolling a die. Either show work or explain how your answer was calculated. x 1 2 3 4 5 6 sum p...
  37. motion analysis

    Using the information below estimate the time required to analyse the data collected using the two motion analysis systems when there are 10 markers on the subject and the data is collected for 100 frames. Cinematography system 2 seconds per marker 5 seconds to change frame ...
  38. motion analysis

    Using the information below estimate the time required to analyse the data collected using the two motion analysis systems when there are 10 markers on the subject and the data is collected for 100 frames. Cinematography system 2 seconds per marker 5 seconds to change frame ...
  39. math

    Robots are being used with increasing frequency on production lines to perform manotonous task. To determine whether a robot welder should replace human welders in producing automobiles, an experiment was performed. The time for the robot to complete a series of welds was ...
  40. 2nd time posting bc i still need HELP! PHYSICS!!!!

    The velocity of a diver just before hitting the water is -8.6 m/s, where the minus sign indicates that her motion is directly downward. What is her displacement during the last 0.86 s of the dive? im so stuck. i tried this problem several times, and my answers werent correct. ...
  41. English

    What winter sport do you like most? 1. I lke curling because it's fun to see players hit big stones. 2. I like bobsledding because it's thrilling to ride a bobsled. 3. I like speed skating because I like wild races. 4. I like ski jumping because I like flying in the air over ...
  42. Calc 121

    Okay, how would you go about finding the area of a curve from 1 to 4, when y=2x+(2/(x^2))?? It's not like the problem I asked before because here, you cannot use substitution. I tried using 2x for u and x^2 for du but it won't simplify into a ln problem or anything that I can ...
  43. I'm in desperate need of h

    I'm in desperate need of help for a huge titration lab and finding the molarity. if I give you the problem could you help?
  44. Science Biology

    Explain how the roles different parts of a plany have in converting light evergy into chemical energy. I need it broken down into easier terminology.
  45. Math

    Hi i'm having trouble with a question. it states During the Summer you take 2 part time jobs. The first job pays $5 per hour. The 2nd Job pays $8 per hour. You want to earn at least $150 a week and work 25 hours or less a week. Write a system of inequalities that model the ...
  46. Math

    Romeo and Juliet are moving in the xy-plane. Juliet starts at the point (0,20( and moves in a straight line at a constant speed. She will pass through the origin in exactly 5 seconds. Romeo starts at the same time from the point (30,0) and moves in a straight line at a ...
  47. chemistry

    My question is found in the analysis section. Thanks to all who can help Lab: Determining Ka of Acetic Acid Purpose: The purpose of this experiment is to determine the molar concentration of a sample of acetic acid and to calculate its Ka. Materials: phenolphthalein 125 mL ...
  48. Recycling speech

    Hello, I am writing a recycling speech and I am almost done. I just need to use three stylistic devices. I know what it is, like metaphors and them. So, what would be good examples of stylistic devices that i can put into my speech. My topic is mainly encourages people to ...
  49. Where are the teachers?

    I really need help and no offense but I would prefer Dr.Bob or Writeacher or somebody that knows what they're doing. Where are they? okay well i'm not a teacher but i will try to help if i can. i'm a tutor if that gives you any confidence Okay, how do you find the equation of ...
  50. math

    Two friends decide to cycle to a picnic spot the first person cycles 5 and a 1/2 km/hour and 2nd cycles 6 and a3/4 km/hour to make up for being slow the first person starts out two and half hour earlier after how much time and distance will the 2nd person catch up with the ...
  51. calc

    oil is leaking from a pipeline on the surface of a lake and forms an oil slick whose volume increases at a constant rate of 2000 cubic centimeters per minute. The oil slick takes the form of a right circular cylinder with both its radius r and height changing h is given by V= ...
  52. english help please!!

    Which of the following is a strong post-reading strategy? Paraphrase each line of the entire story by hand. Write an essay without looking at your notes. Discuss difficult concepts with other people. *** Loan the book to a friend to read after you. is it c pls help me
  53. english

    Hi, I only need help in the questions. "The Turtle and the Rabbit Run a Race," #38 Swapping Stories Bel Abbey, Elton, Louisiana I'm going to tell you about the story about the Rabbit and the Turtle running a race. They were going to run a race one time. And Rabbit run so fast ...
  54. Holidays

    Can u give me some very good websites for making homemade presents for teenage girls (for christmas). Please. Like i want very cool gifts only homemade because me and my friends don't really buy anything for each we like making each other homemade gifts. Thank You !!! :)
  55. chemistry

    Anyone good at making CHEMICAL CROSSWORD PUZZLES ? I have no clue on like any of these things. Like, i need to make the chemical crossword puzzles by using atleast 10 words! example: ....... TABLEEEEE! then ,,,,,,, ACROSS 1._______ 4._______ 7.________ 12.________ 13._______ ...
  56. jobs 4 teens

    im a 13 year old girl and i just want to ask if i coul be able to get a job at my age ? i live in the uk and i want to gt some money but i don't know if i will be able to. I babysit. My mom made be take a babysitting class and CPR. Parents like that I took training so I could ...
  57. MLA Help

    Can someone (preferably an english teacher) check my margins? This is the first time I've had to put an essay in true MLA format. He said that he wants the lines double spaced and a margin of 1 inch. However, I don't know whether I'm supposed to put a space between paragraphs ...
  58. social studies

    With respect to dealing with abstract concepts, which statement is most accurate? A. Emotions have no place in any kind of academic essay. B. An essay dealing with abstract concepts can appeal to intellectual curiosity. C. An essay dealing with abstract concepts should reveal ...
  59. math

    last year mc donald sold 5*10^9 packet of french fries. if we put french friesbend to end estimate the total distance? calculate the order of magnitude?compare the distance? i need to see details in calculations plz thank you
  60. chem need help

    The most prominent line in the atomic spectrum of mercury occurs at a wavelength of 253.652 nm. What is the energy of 0.625 moles of photons associated with the most prominent line? Express answer in kJ. ANS: 295 kJ Please explain.. Thank you so much!
  61. Calc

    Find the equation of the tangent line to f(x)=sqrtx^2+6x at x=2, give your answer in slope-intercept form
  62. Math

    Find the equation of the secant line to the graph of y= 2x^3-3x^2+4x-1 from x=1 to x=3. Give your answer in slope-intercept form.
  63. 8the grade math

    use a grid and lengths of line segments to give a geometric argument
  64. Geometry

    There are three points on a line, A, B, and C, so that AB = 12 cm, BC = 13.5 cm. Find the length of the segment AC . Give all possible answers.
  65. Quote Analyzation

    "I backed away from him until I was atop the forecastle deck. The line of the crew had split, some to either side. 'Help me!' I appealed to them again. But though they were deaf to Captain Jaggery, they were equally deaf to me. The captain, in careful pursuit, now slowly ...
  66. Language Arts

    the trouble with television Robert MacNeil voices a strong opinion about television in a paragraph explain his opinion then tell whether you agree or disagree with him support your view with at least two pieces of evidence from MacNeil's essay or from your own reading or ...
  67. COM155

    Use at least five adverbs and five adjectives to write a brief review of a movie, sporting event, musical performance, or television show. Bold each adverb. Underline each adjective. Compare the event to one or more similar events. When comparing, use at least three ...
  68. help!

    A horizontal translation is applied to the graph of y= X^ 3 + 2 so that it will pass through (3, 10) what is the new equation for the graph? how do I do this? When x=3, one wants y to be 10 y= (x+a)^3 + 2 20= (3+a)^3 + 2 solve for a. I would change it to 18=(3+a)^3 and take ...
  69. social studies

    I need help in evaluating 2nd grade social studies standards according to Arizona Academic standards.
  70. Algebra

    You made 2 deposits to your bank account this month. 1 deposit was $17.92 and the 2nd was $15.33. Your balance at the end of the month is $72.31, and you made no withdrawals. What expression shows your balance at the beginning of the month? My thoughts ending balance = $72.31 ...
  71. Science PHYSICS

    Hi there, would someone be able to tell me if this is right or almost right or really not right?! The scenario being explaining the transfers and conversions of energy of a diver. from walking up the steps to standing at the top of platform to jumping into pool and to start ...
  72. Biology

    I need help with DNA conversion. First of all, I needed to convert this DNA sequence into its RNA equivalent. 5'-TACTTCTTCAAGACT-3' After the conversion, I came up with this.. 3'-AUGAAGAAGUUCUGA-5'. Is this correct? Then I need to take the converted sequence, and once again ...
  73. English

    Hello! i have to pick 3 news articles on a topic that i have chosen,and i have to write an essay to show "how these newspapers and or news magazines present representation of truth and reality designed to appeal to a particular audience.discuss, making reference to the way the...
  74. Ruminant Nutrition (college)

    I'm studying for a Ruminant Nutrition final exam and have a couple essay questions that I'm really struggling with... - How do ruminants fit into sustainable food production systems? - Assume that you can genetically modify a rumen microbe to perform any reaction (e.g., ...
  75. English

    NEED HELP ASAP! You need to have read the short story "The Jade Peony" by Wayson Choy, to help me with these questions. I'm writing a personal response essay to this story and don't know these questions? Help? 1. Did any of the characters change the way they saw the world? 2....
  76. Physics

    A 120 kg football player tries to dive into the endzone at 7.5 m/s to score a touchdown. A 150 kg player dives out of the endzone into the other player at 5 m/s to try and stop him. They collide at the goalline and the tackler holds on to the player diving into the endzone. ...
  77. verbal reasoning

    write the word of four letters which could go after each word in this line losing winning in out be thank you if you help. if you don`t help it`s OK at least you got my question
  78. English

    The extreme poverty of Dakar, Senegal, in “Hip-Hop Planet” is best reflected in which image? a. “When I looked into his eyes, they were bottomless oceans.” b. “. . . it pulled me to the earth like a hundred-pound ring in my nose.” c. “. . . they take every bit of...
  79. English

    The extreme poverty of Dakar, Senegal, in “Hip-Hop Planet” is best reflected in which image? a. “When I looked into his eyes, they were bottomless oceans.” b. “. . . it pulled me to the earth like a hundred-pound ring in my nose.” c. “. . . they take every bit of...
  80. geometry

    Suppose line PQ has endpoints P(2,3) and Q(8,-9). Find the coordinates of R and S so that R lies between P and S and line PR is congruent with Line RS which is congruent with line SQ
  81. algebra

    I need help with this question please: Solve the inequality. Give the result in set notation. (If you need to use or –, enter INFINITY or –INFINITY, respectively.) -25 5x < 30 {x | 1 x < 2}
  82. native american history

    Discuss the divisions between the traditionalists and moderate Indians from WWII on. Why does this war help to produce a sharp division between them? How did the actions of the government fully deepen it? -Can someone give me a website that will help me find these answers for ...
  83. precalc

    I;m not sure if i am doing this right...I keep getting a negative intersection point, which doesn't seem possible. Please help! a) find the equatoin of line 1 which passes through (1,3) and (9,7) I get y=3+1/2(x+1)or y=1/2x+2.5 b) the line 2 is perpedicular to line 1 and ...
  84. economics

    Investors have set the following expectations for profitability and earnings: ROI first year must be at least 17% Turnover in the first year is budgeted at DKK 3,400,000, oo excl. VAT and the total investment Amounts to DKK 4.000.000, oo excl. VAT. 1.1 How much profit should ...
  85. English II B

    A student has completed a freewriting exercise. The result is a paragraph exploring the general theme of war in a literary text. What is the next step in the writing process? 1.gathering details 2.beginning an outline 3.writing an introduction 4.narrowing the topic Need help ...
  86. algebra

    Can somebody please help me with these problems? Factor the expression on the left side of each equation. Then solve. 1)x^4-5x^2+4=0 2)x^4-8x^2+16=0 Please and thank you! 1) let y = x^2, then y^2-5y+4=0 (y-4)(y-1)=0 y = 4 or y = 1 x^2 = 4 or x^2 = 1 x = -2, +2, -1, +1 same ...
  87. algebra review!

    it says write the equation of the vertical line that passes through the point (7,-3). what do i need to start it off? find the equation for the line with undefined slope and passing through the point (-1,-2). what do i need to start that off? what equation do i use to find the...
  88. how to write 2nd may 2011 in 5 letters without usi

    how to write 2nd may 2011 in 5 letters without using numbers
  89. Writing

    Please grade my ACT writing test on a scale of 1-Please make corrections and give me feedback. By the way, I wrote this essay in 30 minutes. ACT Test Prompt: Schools in some states have changed their school calendars so that they are now year-round schools. Advocates of year-...
  90. 10th grade Honors English

    What is my English teacher asking? Here is the prompt. Life can be considered a series of stories. It is the narrative we tell and hear the create the life the we live. And it id through these narratives that messages are passes. "October Sky", "Celebration of Grandfathers", ...
  91. sociology

    what is digital device
  92. Language Arts

    I'd like to know if I answered these correctly. 1.Both the Whitman poem and the Dickinson poem are examples of poetry that? A. abandons conventional rhyme and meter. B. stresses the pangs of unrequited love. C.praises the work of ordinary people. D. captures the cadence of ...
  93. discrete

    we have 20 kinds of presents. we want to give 12 children presents but each child doesn't need to get one. No child can get 2 copies of the same present. in how many ways can we give presents? please explain! the answer is (2^20)^12 but i don't see why
  94. algebra

    write an equation of the line containing the given point and parallel to the given line (3,-3) 7x-2y=5 need help please 7(3)-2(-3)= 5 ? 21- 6= 5? this does not look right, please show me where I am supposed to place the (3,-3)to solve the equation thanks
  95. english

    Poem Styles: IVAN THE EVIL Use story clues to create a visual or poetic representation of Ivan. Be sure to represent actual details of Ivan’s appearance as conveyed by the story, such as his enormous bulk, his red sash, his long beard, and his pointed teeth. ...
  96. Response Essay (Writeacher!)

    How should I begin this? This response essay regards "Rules of the Game" by Amy Tan. The prompt: In Amy Tan's "Rules of the Game," we read about a generational tug of war. Write 3-paragraph essay in which you discuss the motivation of each generation. My thesis: Both Waverly, ...
  97. Geometry

    If you like to snow ski, then you will like Colorado. If you like to wakeboard, then you will like Florida.
  98. Sign Language

    Write your ASL weather report or dialogue in English. Interpret your dialogue or weather report into ASL Gloss. Remember, ASL Gloss is written using only CAPITAL LETTERS. Write the English sentences line by line (not in a paragraph). Write the ASL Gloss phrase on the blank ...
  99. physics

    A ballistics pendulum is a device used to measure the speed of a fast moving projectile such as a bullet. A bullet of mass 5g is fired into a large block of wood of mass 1.5kg suspended from some light wires. The bullet is stopped by the block and the entire system swings ...
  100. Essay Topic (Synthesis)

    Is the topic of Immigration Reform in the United States to controversial for my synthesis essay? I am writing a synthesis essay for my class, and it is a big portion of my grade. I have a lot of information about Immigration, but I'm afraid the topic will be too controversial ...
  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. 16
  18. 17
  19. 18
  20. 19
  21. 20
  22. 21
  23. 22
  24. 23
  25. 24
  26. 25
  27. 26
  28. 27
  29. 28
  30. 29
  31. 30
  32. 31
  33. 32
  34. 33
  35. 34
  36. 35
  37. 36
  38. 37
  39. 38
  40. 39
  41. 40
  42. 41
  43. 42
  44. 43
  45. 44
  46. 45
  47. 46
  48. 47
  49. 48
  50. 49
  51. 50
  52. 51
  53. 52
  54. 53
  55. 54
  56. 55
  57. 56
  58. 57
  59. 58
  60. 59
  61. 60
  62. 61
  63. 62
  64. 63
  65. 64
  66. 65
  67. 66
  68. 67
  69. 68
  70. 69
  71. 70
  72. 71
  73. 72
  74. 73
  75. 74
  76. 75
  77. 76
  78. 77
  79. 78
  80. 79
  81. 80
  82. 81
  83. 82
  84. 83
  85. 84
  86. 85
  87. 86
  88. 87
  89. 88
  90. 89
  91. 90
  92. 91
  93. 92
  94. 93
  95. 94
  96. 95
  97. 96
  98. 97
  99. 98
  100. 99
  101. 100