Stats- need someone to check

65,650 results

Language arts

Always to remember essay Can someone check my answer I need help I’ll post it if any one will help me and i read the book already I just need someone to help me check it


100 people set up a phone call system so that the initial contact person call three persons, each of whom calla three persons,and so on until all have been contacted. The maximum people who do not need to make calls is? Very Simple Question How would you solve it: (1+x^2)(1-x^...


Could someone please explain to me how I would read a z table. I have a z score of 2.2 and I need to know what the percentages is. Then if I'm given 8% how do I find the z score?

Pre Algebra Math

Hi I rlly need someone to check my answers ASAP, and I need help on number 5, im totally fried >.< I can't get any attachments up, but any of you took the Polygons and Angles Quiz? Pretty plz with cherries on the top I need help!


Good morning. I need help solving 2 problems for chemistry. For #1 I need someone to check my work and tell me if I did it wrong and show me how and where I went wrong. And for #2 I need someone to help me figure out how to solve it and explain. 1. With the balanced equation ...


Hello, can someone help me solve and check the following 1) x - 8 = 20 Check: 2) x + 15 = 35 Check: 3) -x +6 = 3 Check: The symbol 'x' is in italic. If I can understand the symbols better, I belive I can get the hang of the course.


I need someone to check my answer on this question in an English quick check. Thanks :) 1. In adventures of huckleberry finn what is unusual about the house Huck and Jim find? A. it is completely empty B. it is floating C. there is no furniture I think A?


Hello, can someone tell me if I got the following solve and check work correct? 1. solve and check 1/2x = 3 5/6 1/2x = 3 5/6 1/2x = 23/6 3x = 23/3 x = 23/3 And to check for it 1/2x = 3 5/6 1/2x = 23/6 46x = 6 x = 6/46 x = 3/23 2. Solve and check 3x + 2 / 2 = 7 3x + 2 / 2 = 7 ...


Please check my answers to my question, I posted this question before but no one answered or helped me. All I need is for someone to check my answers :)


Can someone help me with mechanics. I need to check my answers


I have no money at all no credit card or checks or anything! So can someone please tell me where to get a free background check or free record check?? I really need this please!!

Math 222

I need someone to check this to see if I am doing it correctly. k^3+k k^2+k-42 k(k^2+1) (k+7)(k+6) k=-7 k=6 (-0,-7)(-7,6) (6,0)

English and grammar

i need someone to check my work but i cant just copy it and paste it here. i need to send it via e-mail. please give me your email add and ill send it to you. thanks


Of 43 bank customers depositing a check, 18 received some cash back. (a) Construct a 90 percent confidence interval for the proportion of all depositors who ask for cash back. (b) Check the normality assumption.

Math Check

Hi! Can someone check this for me? My teacher wants me to write the system of equations that will correspond to the final matrix. I have the matrix already, but I need help with the writing the system stuff. Thanks! Matrix: [-10 2 | 48] [-5 -6/4 |-9] My answer: 10x+2y=48 -5x+-...

Math 157

Can someone please help me. At a quality control checkpoint on a manafacturing assembly line, 10% of the items failed check A, 12% failed check B, and 3% failed both checks A and B. a. If a product failed check A, what is the probability that it also failed check B? b. If a ...


Can someone please help me. At a quality control checkpoint on a manafacturing assembly line, 10% of the items failed check A, 12% failed check B, and 3% failed both checks A and B. a. If a product failed check A, what is the probability that it also failed check B? b. If a ...


I Need Someone to check my essay for me and give me some input please.


Of the two fractions 15/21 and 19/17 which is smaller? I think its 19/17 but need someone to double check please.


Could someone check this for me please? The equation is 2/x+3 = 4/x+7, and I think the answer is x=1, I just need help showing the steps of how to get there if anyone knows? Many thanks for any help


I need someone to check my answer, can someone please help me? Here is the problem: Business and finance. In a bottling company, a machine can fill a 2-liter (L)bottle in 0.5 second (s) and move the next bottle into place in 0.1 s. How many2-L bottles can be filled by the ...


Please check my work i am in connecus and i can’t add in the pictures but if possible can someone check this. This picture is called “ the wounded foot” and it’s by Joaquin sorolla y Bastida and I really hope someone can check this answer thanks In this scene the ...


"Find the slope of the line passing through J(0,5) and K(-1,2)" I did the problem but I just need someone to check if its right. my work: M= y2 - y1 -------- x2 - y1 M= 2 - 5 ----- -1 - 0 M= -3 ---- -1 M= 3 Thank you.


is there a good, relevant sites where i can get stats extra help?

Stats- need someone to check

Doing this assignment and was wondering if i got the right answers According to the Census Bureau publication Current Population Reports, the probability distribution for household size (number of people per household, say X) in the United States is as follows. For the purpose...


Use this z-score formula for this problem: z = (x - mean)/(sd/√n) x = 1.25, 1.50 mean = 1.35 sd = 0.25 n = 40 Calculate two z-scores, then use a z-table to determine probability between the two scores. I hope this will help get you started. •stats. - Christina, Monday...


i was wondering if someone could check the answer i got for this math problem 7+2(5-2*9) = 243 I got -19 I think you're supposed to do the parentheses first...but within that, you're supposed to do the multiplication and THEN the subtraction, and then mult it by 2....then add ...


Scientists wish to test the mind-readiing ability of a person who claims to have ESP. They use five cards with different and distinctive symbols( square, cicrle, triangle, line, squiggle). Someone picks a card at random and thinks about the symbol. The mind-reader must ...


1. I need someone to find some photos to post on the blog. 2. I need someone who will find some photos to post on the blog. 3. I need someone who will find some photos so as to post on the blog. ---------------- Are they all the same? Does #1 mean #2 or #3...


I need to do a project for ap stats. It can be anything im interested in, and i have to perform some tests and all that I need some ideas!! Somthing that would be interesting..

rounding numbers

I need to to round 423,607,492 to the ten thousands. I then need to round it to the million. Can someone help me. I will be happy to check your work. Which numeral is in the ten-thousand place in this number? Which numeral is in the million place? Once you have those ...

I need someone to check this

Add and Simplify: 100x/x+10 + x^3/x+10 I have the answer as X^3+100x/X+10 is this correct?

Algebra II repost- please check

I posted these a little while ago but this time I have answered them. 1. Does the graph of y = x – 3x2 + 5 have a maximum or minimum? 2. What is the vertex of the graph of y = -2(x - 3)2 + 4? 3. Does the graph of y = -2(x - 3)2+ 4 open up or down? My answers: 1. I cannot ...


Can someone help me with mechanics. I need to check my answers


Can someone please check my answers below for accurateness? The instructions are: Differentiate and simplify. 1) y=(2x^2+3x-1)(3x^2-5x-3) y'=(4x+3)(3x^2-5x-3)+(2x^2+3x-1)(6x-5) 2) y=(5x^2+3x-1)(3x^2-5x-3) y'=(10x+3)(4x^2-3)+(5x^2+3x-1)(8x) 3)y=6x^3-7x^2+5x-7+x^(5/3)-7/(x^3) y...


I really need someone to check my answers so please check. 1.) Hurry down the hall for your next meeting. Phrase: down the hall for your next meeting Verb: hurry Subject:(you)

Human Disease

I am really stuck and am in need of websites or someone to point me in the right direction. I am doing a research paper and need to know what body systems may be affected by obesity? Can someone help me please?


please please someone check my work I don't understand it fully so I am asking if someone could please check my work thank you if it's too much I'm sorry. God Bless


Could someone check my answer? I need to figure out the equation of the circle given the center of (-9,0) and radius of 7. (x-(-9))^2 + (y-0)^2 = 7^2 answer(x+9)^2 + (y-0)^2 = 49 is this correct?


find critical z values, in each case assume normal distribution applies. left tailed test. Alpha= 0.05 Can someone please explain how to do this?

Math - Could Someone Check My Work?

Could someone check my work please? Thank you! (14a^2b)(2ab^2c) = 28a^3b^3c (a^25)^7 = a^125 6x^6 ∙ 6x^6 = 36^12 (2x^2)^3 = 8x^6 (-2)0 = 1 30x^20/(6x^9 = 5x^11 4x^5 ∙ 6x^6 = 24x^11 (2x^4)^3 = 8x^12 -4^2 = -16 -(193)^0 = -1 (-193)0 = 1 (-5)2 = 25 ((6x^7)/(2x^2 ))^2...

Spanish Preterite Check!!!!

Could someone tell me if these are the only things that I need to know for the Preterite? - the time expressions -the ar and er/ir endings -the car,gar,zar endings for the yo form - no written accents: ir,ser,ver,dar are there any other irregular endings? I think what I wrote ...


I need someone to check and go over my answers to make sure they are correct and if not could you go over them with my on why and how to solve correctly?? Thank you much appreciated.. Add. -4/5 + (9/20) = 5/25 1 + (-2) + 3 + (-4) = 10 5/3 + (-4/3) + 5/3 = 6/3


I need someone to check and go over my answers to make sure they are correct and if not could you go over them with my on why and how to solve correctly?? Thank you much appreciated.. Add. -4/5 + (9/20) = 5/25 1 + (-2) + 3 + (-4) = 10 5/3 + (-4/3) + 5/3 = 6/3


I NEED SOMEONE TO CHECK THESE PLEASE!!! IF B IS REPLACED WITH A NUMBER THAT SHOWS THE RELATIONSHIP INDICATED IN THE TABLE, ARE THESE ANSWERS CORRECT? Y = -X + B X Y 1 0 2 -1 8 -7 10 ? 20 ? 40 ? SO, y=-1+1=0....y=-2+1=-1.......y=-8+1=-7........y=-10+-3=-13...y=-20+1=19.....y=-...


PLEASE HELP Could someone check my answer? I need to figure out the equation of the circle given the center of (-9,0) and radius of 7. (x-(-9))^2 + (y-0)^2 = 7^2 answer(x+9)^2 + y^2 = 49 is this correct?


using a calculator need p value on a r tailed test if the n=9 and the t is 3.204


Need help finding the area under the normal curve between z = -1.0 and z = -2.0?

C++ Programming

Design and create a class named Stats that has an array of 12 doubles as one of its member variables. The values in the array should be set by making 12 calls to a public member function named setValue that accepts two arguments, an integer indicating which value is being ...

Polynomials check my answer

My brother said I did this wrong can someone check this for me please X Y-1 = sum(x)+ (y-1)=(X+y-1) diff(x)-(y-1)=(x+y+1) Product (x) (x-1) = (xy-1) = (xy-1)


Think I know the answer, but can someone please confirm... Find the value of a that corresponds to a confidence level of 84%. Answer: 0.16???

Math, Can someone check my answers?

Can someone please check my answers? Tell whether the given equation has the ordered pair as a solution. 11. y = 6x;(3,16) 13. y = -4x; (-2,8) 15. y = x - 3/4; (2,1 1/4) Answers: 11. Not a solution 13. Has a solution 15. Has a solution


What data and stats do you need to know in order to identify profitable nations in which to export.


Hi, I need someone to double check my answer because it doesn't seem right to me. Find the centroid of the region bounded by y=0 and y = x^2 -2x. I calculated the area to be 4/3 and centroid (1, 0.4)... is that correct? Thanks in advance!

career aw

Can someone plz get a website all about photography for me I really need it for a project that is due tomorrow that my teacher assigned but i need a little bit more about what their daily tasks are?!?!?!?!?!?!? I REALLY NEED HELP!!!!! PLZ SOMEONE!!! THANXS

Algebra Can someone who is serious respond

Can someone check my answer please? Find the corresponding y values for x= -2,-1,0,1,2,3 if y= x^-x-2. My answers are under Y. X Y -2 -4 -1 -2 0 -2 1 0 2 4 3 10


I need someone who know a little bit of Spanish. I am having trouble learning the jugar verbs. I need someone who knows them and is willing to teach me. Thanks, Taylor


Suppose that f(x) = 1:5x2 for -1 < x < 1 (0 elsewhere). Determine the following probabilities: (a) P(X > 0) (b) P(X > 0:5) (c) P(-0.5 < X </= 0.5) (f) Determine x such that P(X > x) = 0.05 (g) Find the cdf of X. could someone just get me started , I don'...

Alg 2

Ok heres another factoring that I need someone to check Problem: -x^3 + 27 -(x^3 - 3^3) So I moved the positive and found out what cubed would make 27 Using the forumla: (a-b)(a^2+ab+b^2) -(x-3) (x^2 + 3x + 9) Right? Or did I make a mistake?


Ok heres another factoring that I need someone to check Problem: -x^3 + 27 -(x^3 - 3^3) So I moved the positive and found out what cubed would make 27 Using the forumla: (a-b)(a^2+ab+b^2) -(x-3) (x^2 + 3x + 9) Right? Or did I make a mistake?


So i have a test in stats tomorrow and im trying to work on my study guide but im stuck at this question : Construct a confidence interval for the proportion for each case 90 percent interval 861 out of 2500. please help.


i need someone's help What do you need help with? Please put your question on the board and someone will be more than please to help. thanks for asking Jiskha.

Spanish 3

Hello! I need someone to check over my Spanish answers and see if I have them right. And if I don't, can someone please help me? Thanks a bunch! :) Directions: Re-write using Direct and Indirect Object Pronouns when needed. 1.) I read the book to Helena. My answer: Leí el ...

previous post

has anyone read my 4 previous posts? I really need someone to check my answers. Please be patient, Erin. Our advanced math teachers are not online right now, it seems. =)

adult education

I need help with someone to go over my eassy with me can someone please help me.This is my first time using this site so I don't know how it really works SOMEONE PLEASE HELP ME!!

Math check my answers

I posted this before can someone please check my answers and help me thanks:) 2 rectangles have equal areas determine the area of each rectangle then use this info to determine the perimeter. rectangle one: length of 2p + 3 width of 3.8 after my work i got p= 1.5 so the area ...


A check returned by a bank because the issuer's cash account balance could not cover the check is called a(n): a. Cancelled check b. Certified check c. Outstanding check d. NSF check


so i have this 5-3 gene sequence and i need to transcribe it to a polypeptide and im not sure my trascription is right could someone check gene sequence(ACCTGATGGCCGTTAATCTATTTAAGGCCTGAAGTAACGTATGG) trans(ThrTrpProLeuIleTyrLeuArgProGluValThrTyr)


Has anyone taken the colorado connections academy Unit 13: Functions Test Unit 5: Functions, within the past day? I need someone to check my answers


Can someone please check this sentence. I want to make sure I DON'T need a comma in the sentence. THANKS! I have found her to be extremely competent in areas by exemplifying her creativeness through many challenges she has taken upon herself.

I really need help!

Hi, I really need instructions. Can someone please tell me how to make a coordinate plane and a rectangle on the plane in Microsoft Excel 2013 please? I really I need an answer soon because this is due today!!!! Please someone help fast! Thank You :/

early childhood in language arts

to be an effective worker in an inclusive early childhood classroom, you: A. Need a great deal of special training B. Must have prior experience in a pediatric care environment C. Need to think of exceptional children as different D. Will need to collaborate with other ...


Five chips numbered 1-5 are placed in a jar. Two chips are drawn. Let Z= the sum of the numbers. WHat is the expected value of the random variable? I know I have to use E = np Can someone explain?

Math check answers please

Sorry to bug again but can someone check my answers please thank you. 1. Simplify the expression 3w-10w A. 13w B. -7w C. -7 D. 7w 2. Y+2y+3z A. 2y+3z B. 3y+3z C. 2y^2+3z D. 6yz 3. 6r+r-5r A. 2r B. 1r+r C. 0r D. 7r-5r 4. 5x+2(x+6) A. 7x+6 B. 7x^2+12 C. 7x+12 D. 7x (x+6) 5. -3m+...

History of health care

Please check my answer thanks :) If you need to talk to someone about getting additional coverage to Medicare Parts A and B what organization should you contact ? I am not to sure is it Blue cross and Blue Shield


Could someone please explain this problem to me. I need to factor and check by multiplying. 7x^9y^7+35x^7y^6+35xy= Here is what I got but I don't think that it is right. 7x^9y^7+35x^7y^6+35xy= 7xy(x^8y^6+5x^6y^5+5) Is this correct? Thanks.

7th grade

You need to give examples for someone else if they would need help on controlled experiments which includes pictures that you give and someone tells if it is a controlled experiment or what the variable is

Asap can someone pplz check these answers

Please check my answers I have 2 do other things right now


If you earn the grades of 81, 84, 78, 80 in four tests what should your final test’s score be in order to have an average of 81%? .81x400=324 Need a total of 324 pts Test grades so far 81,84,78,80 = 323 324-323=1 You need at least one more point to get an 81 Can someone ...

math-please check my answer

0.6x + 4 < 1.0x - 1 6x + 40 < 10x - 10 4x > 50 x > 12.5 can someone please check my work and tell me if I am right?


Can someone please explain how to find the frequency from: Lower limit:230,240,250 upper limit:239,249,259 Mid Value:234.5,244.5,254.5


About 35% of the population has blue eyes (based on a study at Indiana University). a. If someone is randomly selected, what is the probability that he or she does not have blue eyes?


1. You need to check the time. (What kinds of time should be checked acording to the sentence? Does ' check the time' have a lot of meaning according to the context? Does it also mean "Check what time it is now.?"


I need to find the second derivative of y=x(x-1)^1/2. I found the first derivative is 2x-1/2(x-1)^1/2, if someone could check, but I am miserably stuck on the second derivative.


A basketball player, standing near the basket to grab a rebound, jumps 73.6 cm vertically. How much time does the player spend in the bottom 15.4 cm of the jump? Ok...after this I swear I'm done! I just need someone to check my final answer, which is 0.0858 s.


For someone to struggle for freedom (any sorts of freedom), do you need to be committed? And if you do, what are some ideas how being committed is helpful to attempt to gain freedom? I thought of one point, I know you need to be committed to gain freedom because you need to ...


I need someone to please check my answer for me... add. -1.6 + (-2.3)= the answer I got was -3.9 is this correct? if not could you tell me why and how to get the correct answer..? thank you

Math Check

Hi! Can someone check my answers? Thanks! Directions: Solve each system by using the elimination method. Make sure to write your answer in (x,y) form. 1.) 3x-5y=2 2x+5y=13 2.) 3x+11y=4 -2x-5y=9 My answers: 1.) (3,7/5) 2.) (-17,5)

Urgent Math please check

Very Important I can get someone to check these for me... I have to get an A, and I was wondering if someone could double check these for me. I am about 95% sure they are right, but just need a fresh set of eyes. I know I've been sending alot, but I really need them to be ...


Angela is conducting a poll on campus to determine the next student representative. How many students does she need to sample for a confidence level of 90% with a margin of error of + or - 5%?

Grammar and Composition

please check these: Divide each of the following words into its prefix, root, and suffix. some words may not have a prefix or a suffix. WORD misused subscribe distorted regression deported interruption prefix dissection postscript implacable PREFIX mis sub dis re de ? pre ? ...


There are 160 patients. 3 of 4 patient gets BP check, how many of them need check?


For each of the following measurements state the number of significant digits: A length of 2.3 meters A volume of 0.65 liters A time of 0.0004 secs A population of 65,000,000 A distance of 1.30 x 104 I got: 1. 2 2. 2 3. 1 4. 2 5. 2 Just need someone to check my answers please ...


can you please check my answers to the questions i realy need to check them if they right or wrong


Thank you very much. I still need you to check a few urgent things, Writeacher. 1)The line is engaged. Would you hold? Would you like to hold the line? Would you like to hang on/hold on? Which are possible? 2)You needn't have bought the milk; there was some already/there was ...


A normal population has mean 100 and variance 25. How large must the random sample be if we want the standard error of the sample average to be 1.5? I know the answer is 12. Would someone please be able to explain! and share what formula they used

Probability/ Stats

Assume that it is known that 95 percent of the launching of satellites into orbit are successful. What is the probability that in the next four launching there will be. Not sure where to start. can someone help me with steps on how to find the answer?

advancing vocabulary skills third edition

i need help on sentence check 2 and final check chapter 1


I need a paragraph telling about myself but i need someone to check it for me. Bonjour mis amis. Je m'applle lisa. Je suis vingt ans. Mon couleur preferee est le bleu. Mon saison preferee est l'automne. Je suis drole, actif, et intelligent. J'ai un appartment a New York. Je ...

Chemistry URGENT

I need someone to check to make sure that I balanced my equations correctly. I have to add a (g) or (s) to indicate gases and precipitates. I am having a hard time figuring out the ions and how to add them, if any of these reactions need a ion could you explain it to me as ...


  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92
  93. 93
  94. 94
  95. 95
  96. 96
  97. 97
  98. 98
  99. 99
  100. 100