Sequences...again

5,611 results

Biology

When making comparison of sequences where some are whole genome sequences while others are partial genome sequences, or a specific glycoprotein sequence, How is it that we are able to make comparisons from these sequences if they all have different lengths?

biology

Below the human hemoglobin sequence are the first thirty amino acid sequences of several other species’ hemoglobins. Inspect the sequences and answer the following questions: Human) h l t p e e k s a v t a l w g k v n v d e v g g e a l g r l A) ml t a e e k a a v t a f w g k...

MATH!!!! SEQUENCES!!!

Find out a formula for the Nth term of each of the following sequences. (i)4 7 10 13 16 (ii)1 3 5 7 9 (iii)20 17 14 11 8 (iv)1 4 9 16 25 (v)2 8 18 32 50

algebra

For each of the following sequences, find an explicit and a recursive description of the pattern. Assume sequences start from n = 1. a. 1, -1, -3, -5... b. 8,2,3,9... c. -2, 0, 0, -2, -6...

geometric sequences

given the geometric sequences:9 90/17, 900/289 find an explicit formula for an, where the first term is a1=9 an= a10=

Biology Help Please!

)Describe the importance of chromatin remodeling process to transcription. Select the four correct answers. a) These alterations can be used to activate transcription of a gene by hiding its enhancer sequences. b) These alterations can be used to activate transcription of a ...

Maths: Sequences need help

The nth term of a sequences of v1,v2,v3 is given by Vn=6 2^n (1):show that for all value of n>1 Vn1=2(Vn-3)?? (2): obtain and simplify the sum of the first n term of the sequence??

Biology

Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5: GCCAAGGCACTACGCTACGTCGCATTATAC ...

Biology

Humans and Gorillas are very similar in terms of their genetic sequences; in a sample of each of their DNA sequences, only ONE difference was found. MY QUESTION: What genetic mechanism could cause this base sequence change? Thanks!

Maths Please Help

Let A=a1,a2,…,ak and B=b1,b2,…,bj be sequences of positive integers such that a1≥a2≥⋯ak≥1, b1≥b2≥⋯bj≥1, ∑i=1k ai≤6, and ∑j i=1 bi≤6. For how many ordered pairs of sequences (A,B) satisfying the above ...

math

How many n-digit decimal sequences (using digits 0-9) are there with k 1s? Decimal sequences meaning you can have as many 0s in front of a number. For example: 000001234557891111 would be consider valid. So how do i come up with an equation? See my response to Sana's question ...

Maths

Consider all 3-term geometric sequences with first term 1 and with common ratio the square of an integer between 1 and 1000. How many of these 1000 geometric sequences have the property that the sum of the 3 terms is prime?

algebra

Consider all 3-term geometric sequences with first term 1 and with common ratio the square of an integer between 1 and 1000. How many of these 1000 geometric sequences have the property that the sum of the 3 terms is prime?

Math

Consider all 3-term geometric sequences with first term 1 and with common ratio the square of an integer between 1 and 1000 (inclusive). How many of these 1000 geometric sequences have the property that the sum of the 3 terms is prime?

math

1. Examine the first four terms in each of the following number sequences: *2, 7, 12, 17 my formula x+5 *7, 21, 63, 189, 567 my formula x(2)+x *1000, 850, 700, 550 my formula x-150 * –10, –6, –2, 2 my formula x+4 For each sequence, what would be the 20th and 100th term? ...

English

For the essay I have to write I have to talk about examples of sequences and montages (which are transitional sequences of rapidly edited images) for the movie "The Gold Rush" by Charlie Chaplin. I'm having a hard time with examples of montages. Can you help please?

Math

I'm learning series and sequences (grade 11). Please check that my steps show I understand what I'm doing/the concept and my answer as well: 5. The consecutive terms of an arithmetic sequences are 3.6, y, 8.2. Find the value of y. This seems to be a sequence question but I ...

Biology

(This question ties into the previous question I posted about mRNA). Use the Universal triplet code to determine the sequence of amino acids that would be generated for each of the mRNA sequences that you generated in question 2. Remember that the reading of mRNA goes in the 5...

Maths

Eric thinks of 2 sequences.One is geometric and the other arithmetic.Both sequences start with the number 3.The common ratio of the geometric sequence is the same as the common difference of the arithmetic sequence.If the 6-th term of the geometric sequence is 96.Find the ...

Computer Organization and Architecture

Write a subroutine MEMCMP for performing a byte-by-byte comparison of two sequences of bytes in the main memory. The subroutine should accept three input parameters in registers representing the first address, the second address, and the length of the sequences to be compared...

Sequences

A = {a1, a1 + d1, a1 + 2d1, …}, B = {a2, a2 + d2, a2 +2d2, …}. Investigate whether A + B and A x B are arithmetic or geometric sequences. If an arithmetic sequence is identified, state its common difference. If a geometric sequence is identified, state its common ratio. (...

Math

A sociology seminar has 7 members (a) They begin each meeting with each member shaking hands with all the other members. No one shakes another member's hand twice. How many handshakes take place? (b)The professor shakes hands with each member of the seminar and in a different ...

Probability

Automated chemical synthesis of DNA has made it possible to custom-order moderate length DNA sequences from commercial suppliers. Assume that a single nucleotide weighs about 5.6 X 10^-22 grams and that there are four kinds of nucleotides. If you wish to order all possible DNA...

Math, Please Help!

Ryan is building matchstick square sequences, as shown ( first one used 4, second one used 7, third one used 10, and the forth one used 13). He used 599 matchsticks to form the last two figures in his sequences. How many matchsticks did he use in each of the last two figures?

Algebra HELP!

Ryan is building matchstick square sequences, as shown ( first figure used 4, second figure used 7, third figure used 10, and the forth figure used 13). He used 599 matchsticks to form the last two figures in his sequences. How many matchsticks did he use in each of the last ...

geometry again again again again

If angle AFB= 8x-6 and angle BFC= 14x +8, find the value of x so that angle AFC is a right angle.

English

Hello. Please help me with a few questions. 1) Which is the correct position of "again" in the sentence: "They have (again)gathered (again)at the square (again)"? 2)Does the phrase "the allegations doubt his integrity" have the same meaning as "the allegations question his ...

Math

A block is a consecutive sequence of the same digit that is not part of a longer such sequence. a.) Determine the number of sequences of 0's and 1's of length 10 in which every block of 1's has an even length. b.) Determine the number of sequences of 0's and 1's of length 10 ...

I don't get this math!

Sequences that increase at increasing rates are sometimes described as “growing exponentially”. However, this is not always a correct use of the word. For example, both quadratic (constant second difference) and exponential growth share this property. Suppose that a ...

biology

Are the DNA template strand and the mRNA sequences similar, or complementary? Are the DNA coding strand and the mRNA sequences similar, or complementary? Are the DNA template and the DNA coding strand sequences similar, or complementary?

Summer School Calculus

Another one for you :P, add these two vectors using trigonometry (again)... 9N[S2W] and 11N[N31W]...Again, I am confused about the angles, I am not sure what value I should use for the cosine and sine law. THANKS AGAIN!!

Sequences...again

Sequence T1 is obtained by adding the corresponding terms of S(sub) and S(sub2). so that T(sub1) = {2.6, 3.39, 4.297, 5.3561, . . .}. We shall write T(sub1) = S(sub1) + S(sub2) to convey the addition of S(sub1) and S(sub2) in this way. Is T(sub1) an arithmetic or geometric ...

Biology

Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC ...

English

1. Can we meet again one day? 2. Can we meet again oneday? 3. Can we meet again some day? 4. Can we meet again someday? (Which ones are grammatical? Which one is commonly used? Thank you. Have a good day!)

geometry again again again

Two angles are supplementary. one angle measures 12 degrees more than the other. Find the measures of the angles.

math

looking for the pattern in these sequences: -2,-1,4,1,4,9,14,27,_,_,_,_

Math

How do I solve this equivalent equation? 5x +2 < 17 (again the <is underlined) Do I subtract 2 from each side so it would read 5x < 15 (again the < is underlined) than divide each side by 5 so the x < 3 (again the <is underlined) is the answer? Also, how do I...

DNA

What nucleotide sequences do not code for proteins?

Math

How to write a recursive rul for sequences. ex.) 1,3,4,7,11

math

looking for the pattern in these sequences: -2,0,1,4,4,8,_ , _ , _, _, and so forth

Sequences and Series

Find the 21st term, 6,5,1,2,6,5,1,2

Sum of geometric sequences

5,15,45,135,....S10

Math

Find formula Number Sequences of 3, 10, 31, 94,.....

Math

Arithmetic sequences Find a8 and an for the sequence: -3, -7,-11

math(sequences)

0.5,1.5,4.5,13.5,... what is the next three terms??? plz help

math

hi can you predict the next sequences possible from the numbers 1-50 05 16 20 30 41

7th Grade Math

What is arithmetic and geometric sequences?

Number Sequences

Explain It. What do you need to do to extend a pattern?

Math

I need to find the fifth term of these sequences. 10. (x^2 - 1/2)^9 12. (x^2 + 2y)^8

geometry

predict the next two numders in this sequences:-5,-2,4,13_,_

MATH

How many six-letter sequences are possible that use the letters c, i, c, c, i, y?

biology

what are the sequences of event hat result in erythroblastosis fetalis

biology

what are the sequences of event hat result in erythroblastosis fetalis

Math

Find the sum of the first 12 terms of the sequences given in #1. a.f(n) = 5*(2)^(n-1) ; for n = 1,2,3,4,… b.a1 = 1/3 ; an+1 = = 3*an

Biology

why do we use protein sequences when comparing genetic similarities?

Biology

How are antibodies used to detect similarities in protein sequences?

sequences help plskthx

what are the next three terms in the sequence -3 6 15 24 35, 46, 57 34, 44, 54 33, 44, 56 33, 42, 51 i think it's d

Series and Sequences

Find the next three terms in the pattern 20,40,60,11,31,51,......

Sequences and Series

Find the next three terms in the pattern, 25,5,30,6,35,7,....

Sequences Math

Find the function rule. X = -2, -1, 0, 1, 2. Y = 9, 4, -1, -6 -11. Help please this is too hard

Mathematics

Which of the following number sequences could be produced by the expression `2x + x^2`? correctA. 3, 8, 15, 24 B. 1, 3, 5, 7 C. 1, -1, -3, -5 D. 2, 7, 14, 21

Math

which of the following sequences is an arithmetic sequence? 5, 20, 80, 320,... 6, 9, 5, 8, 4, 7,... 100, 10, 0.1, 0.01,... -1, 2, 5, 8,...

math

Brilli the ant placed the numbers 1,2,…,n in order clockwise around a circle. She can create an infinite sequence A={aj}∞j=0 of integers by letting a0=k∈{1,2,…,n} and constructing ai+1 from ai by taking the integer that is ai positions clockwise in the circle ...

Math (help steve)

Brilli the ant placed the numbers 1,2,…,n in order clockwise around a circle. She can create an infinite sequence A={aj}∞j=0 of integers by letting a0=k∈{1,2,…,n} and constructing ai+1 from ai by taking the integer that is ai positions clockwise in the circle ...

math

How many five-letter sequences are possible that use the letters a, p, j, e, x once each?

MATH!!!! SEQUENCES!!!

Write down the first 5 terms of the n3 (Cubed) sequence

math

Identify two different divergent sequences a and b who difference a - b converges.

Biology

Which of the following sequences is an example of a point mutation of the DNA sequence -A-A-G-T-G-C- ? (What?) -A-A-A-T-G-C- -A-A-G-U-G-C- -G-T-A-G-A-A-C- -A-A-G-G-T-C-

Math- Sequences and Series

Sn= N^2-4n, using this formula find the first 4 terms

maths

Determine the 10th and 21st terms of each of the arithmetic sequences: 4+7x; 5+9x; 6+ 11x.......

math {sequences}please help

Sequences 1. 14, 19, 24, 29,… a. Geometric, 34,39,44 b. Arithmetic,32,36,41 c. Arithmetic, 34, 39, 44 ** d. The sequence is neither 2. -4, 8, -16, 32, . . . . a. Arithmetic , 64, 128, 256 b. Geometric, -64 , 128, -256 ** c. Geometric, -48, 64, -80 d. Neither 3. 81, 27, 9, 3...

Functions 11: Series and Sequences

4m + 1, m + 1 and 10 - m are the first three terms of a geometric sequence. Find t4.

College Algebra

Solve for the specified variable in each formula or literal equation Sn=n(a1+an/2) for n (sequences)

math

what method i need to use in solving arithmetic and geometric sequences and series?

Math

How many different sequences of ten flips of a coin have at least 8 heads?

Math- Sequences

What are the first four terms of the sequence represented by the expression n(n-2)-3? -5, -2, 1, 4 -4,-3, 0, 5 3, 0, 3, 6 2, 0, 2, 4 I believe it's C?

math

Write the first 5 terms of the sequences defined by the recursive formula t1= 7, tn= 2tn-1 - 3n, n>1

Math

Write three arithmetic sequences with 30 as the sum of the first five terms

mathematics

Shows that each of the following sequences is an A.p and hence find the first 5 terms 3n+4,14-4n,4n-2. Solve it

English

They are arguing about rules and regulations again. I have to identify the adverb. again

calculus hs

Here's the question again How do I find all line through (6, -1) for which the product of x- & y- intercepts is 3? Thanks again

maths

for each of following sequences state whether it converges and if it does to what limit explain your answer to the below An =(6n-3n^3)/(2n^3+4n^2) (n=1,2,3,...)

math

Find the first five terms of the sequences with the nth term given as follows: 4n + 7

biology

What do multicellular genomes spend a larger proportion of their sequences on (in terms of enhanced complexity)?

Algebra, help please!!!

Find the mean and the median in the following arithmetic sequences: A: 1, 3, 5, 7, 9 B: 1, 3, 5, 7, 9, . . . ., 199 C: 7, 10, 13, 16, . . ., 607

Early Childhood

The reason teachers need to know what constitutes typical ages and growth sequences is because:

Science

How can DNA sequences, Stages of Development and Body Structures be used as evidence of evolution?

Calculus

So, yet again, I am confused! State whether or not the following statements are true. Justify your reasoning. a). a• ( b+c ) = a• b + a • c b.) a × ( b+c ) = a × b + a × c c.) a × ( b•c ) = a × b • a × c Thanks, again!

French for Anonymous to Sra

its me again could u please tell me how to say by: to: due: I need it for my title page thanks again:)

science

Me again :) Why might a car manufacturer change the shape of the side mirrors on a particular model? Thanks again.

Sequences and Series

PreCal. What is the difference between the equations (n(n+1))/2, and n/2(ti+tn)?? Under what conditions would you use them? Thanks much!!!

math i need help please

determine sums of following geometric sequences... A. -1/32+1/16-...+256 B. 50 over Σ 8(.5)^n-2 where n=1

math

what formula use in solving or finding for the 9th term of a number in arithmetic series and sequences?

Science

How do I create a cladogram using DNA or protein sequences taken from three different organisms?

Math sequences

Determine the smallest interger n such that 1+(4/5)+(4/5)^2+...+(4/5)^n>4.9 Please explain ti me about thisquestion. I can'tunderstand it.

vocab, again! sorry!

Hi, again. I need help with this word decorum. the def is ADJ proper; seemly correct how do i use this in a sentence?

Statistics

How many sequences contain exactly three heads when you flip a coin five times? 2 15 10 8 12 my answer was 15 ,but that was incorrect

Sequences and Series

use the iterative rule to find the eighth term in the sequence an = 25 − 3n. 176 49<------ My answer 8 1

math

I need to figure out the next two numbers in the following sequences. A)144, 121, 100, 81, B)3, -12, 48, -192,

Statistics

How many sequences contain exactly three heads when you flip a coin five times? my answer was 15 but apparently I am wrong 2 15 10 8 12

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57