SeQuEnCeS and SeRiEs: HELP PLZ!

6,540 results

Math

I'm learning series and sequences (grade 11). Please check that my steps show I understand what I'm doing/the concept and my answer as well: 5. The consecutive terms of an arithmetic sequences are 3.6, y, 8.2. Find the value of y. This seems to be a sequence question but I ...

Series and sequences

Three numbers a,b, and c form a geometric series so that a+b+c=35 and abc=1000. Find the values of a,b,c.

arithemetic progression too hard help plz

find the nth term of the series 1,3,6,11,31,48.... Hence duduce a formula for calculating the sum of the series plz help me show working

Math

In sequences and series::: I don't understand the difference between (for arthemtic series) the equations 1) sn= t/2(ti-tn) 2) (n* n-1)/2 where would you use each one and how are they different?

Biology

When making comparison of sequences where some are whole genome sequences while others are partial genome sequences, or a specific glycoprotein sequence, How is it that we are able to make comparisons from these sequences if they all have different lengths?

SeQuEnCeS and SeRiEs: HELP PLZ!

The first three terms of the sequence -8,x,y,72... form an arithmetic sequence, while the second, third and fourth terms form a geometric sequence. Determine x and y.

Algebra

Using the index of a series as the domain and the value of the series as the range, is a series a function? Include the following in your answer: Which one of the basic functions (linear, quadratic, rational, or exponential) is related to the arithmetic series? Which one of ...

Algebra 2: Sequences and Series

I have this question and I don't understand what it's asking for. It says evaluate, is it asking for the missing term or what? The sequence 21, 23, 25, 27, 29, ..., 41 has 11 terms. Evaluate the related series. * 320 * 341 * 300 * 166 Very confused, any insight on how to solve...

Math

Using the index of a series as the domain and the value of the series as the range, is a series a function? Include the following in your answer: Which one of the basic functions (linear, quadratic, rational, or exponential) is related to the arithmetic series? Which one of ...

Sequences and Series

Find the 21st term, 6,5,1,2,6,5,1,2

series help maths steve or reiny

find the sum of n-term of the series 1/1+1/2+1/3+1/4+1/5+...+1/n plz show step

Series and Sequences

Find the next three terms in the pattern 20,40,60,11,31,51,......

Sequences and Series

Find the next three terms in the pattern, 25,5,30,6,35,7,....

sequence help plz

5+11+17+23 +... Find the sum of the 2n term of the series plz help me show step

Plz do help..GEOMETRIC SEQUENCES

a company gives its employees a 4% raise at the beginning of every year.This year Jordan earns 32000. Could you plz tell me how I get the year at which he earns,$40000?

series

find the nth term awmd partail sum of the harmonic series below 1/3+1/8+1/15+1/12+..........show working plz

math(sequences)

0.5,1.5,4.5,13.5,... what is the next three terms??? plz help

Math- Sequences and Series

Sn= N^2-4n, using this formula find the first 4 terms

maths plz help

give the expansion sin^8@ as a series of cos@ plz help me show working where @ means theta

Functions 11: Series and Sequences

4m + 1, m + 1 and 10 - m are the first three terms of a geometric sequence. Find t4.

math

what method i need to use in solving arithmetic and geometric sequences and series?

miss reiny correct-done

find the nth term of the series 1,3,6,11,19,31,48.... Hence duduce a formula for calculating the sum of the series plz help me show working

Sequences and Series

PreCal. What is the difference between the equations (n(n+1))/2, and n/2(ti+tn)?? Under what conditions would you use them? Thanks much!!!

math

what formula use in solving or finding for the 9th term of a number in arithmetic series and sequences?

Sequences and Series

use the iterative rule to find the eighth term in the sequence an = 25 − 3n. 176 49<------ My answer 8 1

biology

Below the human hemoglobin sequence are the first thirty amino acid sequences of several other species’ hemoglobins. Inspect the sequences and answer the following questions: Human) h l t p e e k s a v t a l w g k v n v d e v g g e a l g r l A) ml t a e e k a a v t a f w g k...

chemistry need help so bad seriously help plz

Use Rydbuz equation to calculate the wavelength of the third line in the paschen series of the hydrogen spectrum.give ur answer in Nm. RH=2.18 * 10^-18j, H=6.63 * 10^-34J. Plz help m

math 12 - sequences and series

Given the expression Sn = n^2 + 2n for the sume of the first n terms of a series, determine a) An expression, in simplified form, for Sn-1 in tmers of n b) an expression, in simplified form, for the nth terms, tn in terms of n

MATH!!!! SEQUENCES!!!

Find out a formula for the Nth term of each of the following sequences. (i)4 7 10 13 16 (ii)1 3 5 7 9 (iii)20 17 14 11 8 (iv)1 4 9 16 25 (v)2 8 18 32 50

series maths steve reiny bob reiny steve!!!

if p is the nth term 8+20+52+.....+p evaluate the sum to n-of the series plz show step

algebra

For each of the following sequences, find an explicit and a recursive description of the pattern. Assume sequences start from n = 1. a. 1, -1, -3, -5... b. 8,2,3,9... c. -2, 0, 0, -2, -6...

math sequences and series

how do i solve if t1=1/2 and tn=tn-1+1/n(n+1), determine an explicit formula for the general term. (hint: it is neither arithmetic nor geometric. write out the first few terms)

Math

So, this "kiddo" needs some help plz! You are having a discussion about sequences with your classmate. She insists that the sequence is 2, 3, 5, 8, and 12 must be either arithmetic or geometric. Is she correct. Explain. HELP I DO NOT UNDERSTAND THIS!!!!! D;

LIVING ENVIRONMENT

the ability to grow in size is a characteristic of living organism .Although an icicle may grow in size over time,it is considered nonliving because there is 1)an incerase in matter ,but no increase in the number of icicle. 2)an interaction between the icicle and the ...

science (check plz)

1)When evolution was first proposed, which of the following was used as evidence to support the idea? A)observations of nature B)laboratory experiments C)extensive fossil collections*** D)genetic sequences

Ms. Sue PLZ HELP!!!(science)

When evolution was first proposed, which of the following was used as evidence to support the idea? A. observations of nature *** B. laboratory experiments C. extensive fossil collections D. genetic sequences

math

identify the value of x that makes each pair of the ratios equivalent x:4 and 45:20 A.8 B.9 C.10 plz plz plz plz help me!!!!!!!! PLZ!!!!!

Math

Evaluate 1/3 + square root(3)/12 + 1/16 + square root (3)/64. I hope this makes sense. Right now we're learning sequences and series and I'm really confused on this question.

geometric sequences

given the geometric sequences:9 90/17, 900/289 find an explicit formula for an, where the first term is a1=9 an= a10=

Biology Help Please!

)Describe the importance of chromatin remodeling process to transcription. Select the four correct answers. a) These alterations can be used to activate transcription of a gene by hiding its enhancer sequences. b) These alterations can be used to activate transcription of a ...

Maths: Sequences need help

The nth term of a sequences of v1,v2,v3 is given by Vn=6 2^n (1):show that for all value of n>1 Vn1=2(Vn-3)?? (2): obtain and simplify the sum of the first n term of the sequence??

I NEED HELP!!:(!!!! HELP ME PLZ!!

I GOT A FEW QUESTIONS SO what is a cell part that has the funcion of a gel-like material inside cells... and what releases energy into the cell.?? plz plz plz plz HELP!!!

Biology

Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5: GCCAAGGCACTACGCTACGTCGCATTATAC ...

math plz plz plz plz help plz .....thank you

mark bought a notebook for $1.45 and some pencils that cost $0.42 each if the total cost was 6.91,how many pencils did he buy A.12 B.13 C.14 D.15 is 14 the answer plz help thank you

sequences and Series

If 5 times the 5th term is equal to the 6 times the 6th term of an arithmetic sequence then its 11th term is.......

simpson

help me integrate these sin(x^2)dx plz the answer is in infinte series

Biology

Humans and Gorillas are very similar in terms of their genetic sequences; in a sample of each of their DNA sequences, only ONE difference was found. MY QUESTION: What genetic mechanism could cause this base sequence change? Thanks!

Math

Consider the following series: 1,2,3,4,5,10,20,40....which starts as an arithmetic series? ...but after the first five terms becomes a geometric series. Prove that any positive integer can be written as a sum of distinct numbers from the series. I know how to do the base case

Excel Help

3) __________ are used to compare sets of data in one chart. Time series Multiple data series Relative series Comparison series Is multiple data series

Algebra 2 Honors

Right now in my class i am learning about sequences and series and im currtently suck on this problem. "A certain sequence is defined recursively by the t1=1 , t2=2, t2n=2t2n-2, t2n+1=3t2n-1. Find the first eight terms of the sequence." thanks for your help.

sequences and series

how do i solve the sum of the first two terms of an arithmetic sequence is 16. the sum of the second and third term is 28. determine the first three terms, algebraically

social studies? i think idk

what new ideas came from the automobile? plz help plz plz plz ASAP

math sequences and series

how do i solve the sum of the first two terms of an arithmetic sequence is 16. the sum of the second and third term is 28. determine the first three terms, algebraically

Math ....urgent help

i just don't get this elimination method ..... plz help me plz.....teach me how to keep the x and y in a parallel line. and which number to multiply.....plz help -5x-4y=-11 10x=-6-y help me plz......

SS plz help me plzzzzzzz

What are the two major forces that reshape earth? Describe how itworks. plz plz plz help me there are no answer choices hope u can still help

Maths Please Help

Let A=a1,a2,…,ak and B=b1,b2,…,bj be sequences of positive integers such that a1≥a2≥⋯ak≥1, b1≥b2≥⋯bj≥1, ∑i=1k ai≤6, and ∑j i=1 bi≤6. For how many ordered pairs of sequences (A,B) satisfying the above ...

math C2 sequences and series

The eight,fourth and second terms of an arithmetic progression form the first three terms of a geometric series. The arithmetic progression has first term A and common difference d, and the geometric progression has first term G and common ratio r. a)Given that d is not equal ...

Calculus

Consider the infinite series of the form: (+/-)3(+/-)1(+/-)(1/3)(+/-)(1/9)(+/-)(1/27)(+/-)...(+/-)(1/3^n)(+/-)... (A) Find x and y from: x(</=)(+/-)3(+/-)1(+/-)(1/3)(+/-)...(</=)y. (B) Can you choose the signs to make the series diverge? (C) Can you choose the signs to ...

calculus

Consider the infinite series of the form: (+/-)3(+/-)1(+/-)(1/3)(+/-)(1/9)(+/-)(1/27)(+/-)...(+/-)(1/3^n)(+/-)... (A) Find x and y from: x(</=)(+/-)3(+/-)1(+/-)(1/3)(+/-)...(</=)y. (B) Can you choose the signs to make the series diverge? (C) Can you choose the signs to ...

calculus

Consider the infinite series of the form: (+/-)3(+/-)1(+/-)(1/3)(+/-)(1/9)(+/-)(1/27)(+/-)...(+/-)(1/3^n)(+/-)... (A) Find x and y from: x(</=)(+/-)3(+/-)1(+/-)(1/3)(+/-)...(</=)y. (B) Can you choose the signs to make the series diverge? (C) Can you choose the signs to ...

SS PLZ HELP ME ASAP

What are the two major forces that shape and reshape earth? Describe how each one works. plz plz plz help me there are no answer choices hope u can still help

Plz do help..GEOMETRIC SEQUENCES

a company gives its employees a 4% raise at the beginning of every year.This year Jordan earns 32000. Write a rule to find Jordan's salary after n years. please help me with this one...

IB Math Studies

I saw a similar post earlier. I also want to see who has better memory out of men and women. I was thinking of testing ability to remember a series of simple objects or number sequences. Could I use chi-squared, HOW could I use it? Any other sophisticated processes? thanks.

Algebra 2

I need steps on how to complete this please i am so confused and lost. :( Consider the infinite geometric series x e n=1 -4(1/3) n-1. In this image, the lower limit of the summation notation is "n=1". a. Write the first four terms of the series. b. Does the series diverge of ...

biology

a boy inherits genes for tallness,but his growth is limited as a result of poor nitrition. this is an example of 1)an inherited disorder. 2)environmental influence on gene expression . 3)expression of a hidden trait 4)a characterstic controlled by more than one pair of genes. ...

math

How many n-digit decimal sequences (using digits 0-9) are there with k 1s? Decimal sequences meaning you can have as many 0s in front of a number. For example: 000001234557891111 would be consider valid. So how do i come up with an equation? See my response to Sana's question ...

English (plz read)

I'm creating is HUGE book series. Can you check to see if the blurb is good. The series follows the journey of a teenage girl who is determined to have best year ever in the 8th grade and to have the best 4 year experience in high school. Please make sure if they any grammar ...

English plz help quick

what literary term is this and why. I think the world is a series of broken dams and floods.

maths pppllllz hellllp me too hard

determine a series if solution of the equation y"(x)+x.y'(x)+y(x)=0 show me step plz

Plz help!!! algebra

convert the decimal 0.6 to a fraction by writing it as a infinite series. I really have no idea how to do this can anyone please help me?

Chemistry

Hydrogen exhibits several series of line spectra in different spectral regions. For example the Lyman series (nf = 1 in Balmer-Rydberg equation) occurs in the ultraviolet region while the Balmer (nf = 2) series occurs in the visible range and the Paschen (nf = 3), Brackett (nf...

algebra, series

The sum of the first n terms of a series is 1-(3/4). Obtain an expression for the nth term of the series. Prove that the series is geometric, and state the values of the first term and the common ratio. Please show workings

Calculus

a) Find the Taylor series associated to f(x) = x^-2 at a = 1. Be sure to show the general term of the series. b) Find the radius of convergence of the series. c)Use Lagrange's Remainder Theorem to prove that for x in the interval of convergence with x > 1; the power series ...

plz plz help me belive me have tried

cosx+cosy=a and sinx+siny=b show that sin2x+sin2y=2ab(1-(2/(a^2+b^2)) plz plz show step

Calculus

Determine the following about the series. Indicate the test that was used and justify your answer. Sigma (lower index n = 1; upper index infinity) [sin((2n-1)pi/2)]/n A. The series diverges B. The series converges conditionally. C. The series converges absolutely. D. It cannot...

Integral Calculus

We can use this power series to approximate the constant pi: arctan(x) = (summation from n = 1 to infinity) of ((-1)^n * x^(2n+1))/(2n+1) a) First evaluate arctan(1) without the given series. (I know this is pi/4) b) Use your answer from part (a) and the power series to find a...

Maths

Consider all 3-term geometric sequences with first term 1 and with common ratio the square of an integer between 1 and 1000. How many of these 1000 geometric sequences have the property that the sum of the 3 terms is prime?

algebra

Consider all 3-term geometric sequences with first term 1 and with common ratio the square of an integer between 1 and 1000. How many of these 1000 geometric sequences have the property that the sum of the 3 terms is prime?

math

for this infinite series (-1)^n/n^2 if i use alternating series test to show that sequence does of a^n does not go to 0, then does this mean that this series is diverging

Arithmetic Series - - Reiny

Consider the series defined by Sn = 3n-1 Find the first four terms of the series. How exactly do I do this?

math

hi if i wanna find the Maclaurin series from another existing series by integrating that series , do i need to include the constant of integration ?? Thanks

Calculus

By recognizing each series below as a Taylor series evaluated at a particular value of x, find the sum of each convergent series. A) 1+5 + (5^2)/(2!)+(5^3)/(3!)+(5^4)/(4!)+...+ (5^k)/(k!)+...= B) 1-(2^2)/(2!)+(2^4)/(4!)-(2^6)/(6!)+...+((-1)^(k)2^(2k))/((2k)!) +...=

Math

Consider all 3-term geometric sequences with first term 1 and with common ratio the square of an integer between 1 and 1000 (inclusive). How many of these 1000 geometric sequences have the property that the sum of the 3 terms is prime?

math

the last two tems in a geometric series are 1080 and 6480 and the sum ofthe series is 7775 what is the first term in the series

math

1. Examine the first four terms in each of the following number sequences: *2, 7, 12, 17 my formula x+5 *7, 21, 63, 189, 567 my formula x(2)+x *1000, 850, 700, 550 my formula x-150 * –10, –6, –2, 2 my formula x+4 For each sequence, what would be the 20th and 100th term? ...

sequences and Series

Wilma has 64 cherries. She gives half the amount of cherries ib her bag to each friend she visits. Rose's house was the fifth house, Wilma visited. How many cherries did Rose get?

chemistry

Hydrogen exhibits several series of line spectra in different spectral regions. For example the Lyman series (nf = 1 in Balmer-Rydberg equation) occurs in the ultraviolet region while the Balmer (nf = 2) series occurs in the visible range and the Paschen (nf = 3), Brackett (nf...

Integral Calculus - Series

Find if series is convergent or divergent. Series from n=2 to infinity (4n+7)/(3n^3 -8n)

English

For the essay I have to write I have to talk about examples of sequences and montages (which are transitional sequences of rapidly edited images) for the movie "The Gold Rush" by Charlie Chaplin. I'm having a hard time with examples of montages. Can you help please?

Geometry i need help urgently plz plz plz

The lenght of a line segement is of 10units and the co-ordinate of one end point are (2,-3) if the abscissa of the other end is 10 find the ordinate of the other end?? Working plz plz

Chemistry

Hydrogen exhibits several series of line spectra in different spectral regions. For example the Lyman series (nf = 1 in Balmer-Rydberg equation) occurs in the ultraviolet region while the Balmer (nf = 2) series occurs in the visible range and the Paschen (nf = 3), Brackett (nf...

calculus

Consider ∞ ∑ [(3k+5)/(k²-2k)]ᵖ, for each p ∈ ℝ. k=3 Show this series { converges if p > 1 { diverges if p ≤ 1 Hint: Determine the known series whose terms past the second give an approximate match for the terms of this series. This ...

plz sequence sir steve reiny bob damon i need u

The three real,distint and non-zero numbers a,b,c are such that a,b,c are in arithmetic progression and a,c,b are in geometric progression. Find the numerical value of the common ratio of the geometric progression.. Hence,find an expression in terms of a for the sum to ...

calculus help me plz too hard show step

charge Q coulombs at time t seconds is given by the differential equation RdQ/dt+Q/C=0, where c is the capacitance in farafd and R the resistance in ohms.solve the equation for Q given that Q=Qo where t=0 plz show step plz plz plz

Calc 2, Series/Sequences

Explain clearly in detail the difference of the summation of n=1 to infinity of 1/n^2; and the integral of 1/x^2dx with the limit of 1 to infinity, as well. Part 2: Explain the natures of the two expressions and explain why the summation is greater than the integral test. The ...

chemistry plz help help

Use Rydbuz equation to calculate the wavelength of the third line in the paschen series of the hydrogen spectrum.give ur answer in Nm. RH=2.18 * 10^-18j, H=6.63 * 10^-34J.

math

the volume of a rectangular solid is given by expressions given below.in each case find the dimentions of the solid. a)15x^2-51x+18. b)x^3+13x^2+32x+20. c)x^2-5x/2-3/2. d)x^4+x^3-x-1 plz everyone help me out.till 2 o'clock...plz plz plz

math

the volume of a rectangular solid is given by expressions given below.in each case find the dimentions of the solid. a)15x^2-51x+18. b)x^3+13x^2+32x+20. c)x^2-5x/2-3/2. d)x^4+x^3-x-1 plz everyone help me out.till 2 o'clock...plz plz plz

Math (College Level Mathematics)

Fourier sin series for f(x) = 1, 0 < x < Pie is given by 1 = 4/n E 1/ (2n-1) times sin (2n-1) x, (0 < x < n). Using this, find the Fourier sinc series for f(x)= 1, on 0 < x < c where c > 0. Then find the Fourier series for g(x), x > 0 where g(x) = 1, 0...

Calculus

Obtain the MacLaurin series for 1/(2-x) by making an appropriate substitution into the MacLaurin series for 1/(1-x). ------------ The MacLaurin series for 1/(1-x) = Σ x^k I substitue (x-1) in for x, because 1/(2-x) = 1/(1-(x-1)) Making the same substitution in the ...

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66