Rank the crystal lattice structures in order of decreasing efficiency of space in the structure.

20,908 results, page 74

  1. Math please help me :(

    Order the expression by choosing >, <, or = . 2^3 × 2^2 _ 2^6 2^2 × 3^2 _ 6^3 2^3 × 3^2 _ 6^2
  2. Linear or Nonlinear, Order.

    (a) y''' + y' - xy = x (b) y'' - y' = xy2 (c)x/y = y' (d)(xy')' = cos x
  3. Math

    How do I arrange these in order from the smallest to greatest 5/6, 7/12, 5/8, 23/48
  4. Math

    order these numbers from least to greatest. 3/20, 45%, 1/5, 7.5%, 27.5%
  5. math

    How do I order the numbers 0.66,7/8,and 1/4 least to greatest????
  6. math

    how you arrange the following to ascending order 8/7, 8/3, 8/4, 8/8
  7. Math

    Place in order from least to greatest -8.2,0.4,2.4?
  8. math

    Order the numbers from least to greatest: 3/25,0.41,10%
  9. Math

    Order the following from least to greatest 0.3 3/5 0.66 2/3 0.35
  10. Math

    Order the fractions from least to greatest 2/3 5/8 1/8 3/4
  11. Math

    2x^3 + x^2 - 5= 0 x=? What is the process I must do in order to get the answer?
  12. math

    can you please help me order 0.8,7/8,81%,and 19/25 from least to greatest?
  13. Statistics

    3 students will represent your school at a conference at the state capital. A drawing will be held to select the 3 representatives from a group of 5 finalsts. If you and your friend are both finalists, what are the chances that both of your names will be drawn? Is it 2 out of ...
  14. chemistry

    What would cause entropy to increase in a reaction? A. The products forming a more rigid structure B. The products forming an ordered pattern C. The products becoming more spread out D. The products forming fewer molecules I think the answer is c or d
  15. chemistry class

    A flask is charged with 0.124 mol of A and allowed to react to form B according to the reaction A(g) → B(g). The following data are obtained for (A) as the reaction proceeds: Time (s) 1 10 20 30 40 Moles of A 0.124 0.110 0.088 0.073 0.054 1) The average rate of ...
  16. physics

    A hydraulic press has an input cylinder 1 m in diameter and an output cylinder 2 meters in diameter. Assuming 100% efficiency, find the force exerted by the output piston when a force of 10 Newtons is applied to the input piston. pounds If the input piston is moved through 5 ...
  17. Chemistry(Please check)

    1) The decomposition of hydrogen peroxide in solution and in the presence of iodide ion was studied in laboratory, and the following mechanism proposed based on the experimental data. H2O2 + I - = H2O + IO - (slow) H2O2 + IO - = H2O + O2 + I - (fast) Which one of the following...
  18. Chemistry(Please check)

    1) The decomposition of hydrogen peroxide in solution and in the presence of iodide ion was studied in laboratory, and the following mechanism proposed based on the experimental data. H2O2 + I - = H2O + IO - (slow) H2O2 + IO - = H2O + O2 + I - (fast) Which one of the following...
  19. Science help.

    Where is most freshwater on Earth found? lakes and rivers oceans and seas underground ice caps and glaciers How does algal growth caused by agricultural waste kill marine organisms? by blocking sunlight and depleting oxygen by increasing oxygen levels in the water by ...
  20. algebra (inequalities)

    a weaver spends $420 on supplies to make wall hangings and plans to sell the wall hangings for $80 each. a. write an inequality that gives the possible numbers of (w) wall hangings the weaver needs to sell in order for the profit to be positive b. what are the possible numbers...
  21. Computer science

    Need help on how write this program. "The Eversoft Eraser Company has a list of its customers’ names (not necessarily in alphabetical order) and telephone numbers in a file named "customer" with records of the following form: last_name (String), first_name (String), ...
  22. Anatomy

    Can someone help me answer these 4 questions I have? Skeletal muscle cell are long and do not branch. Why is this the best structure for this type of muscle? Why does having many long, branched dendrites and axons beneficial for nervous tissue? How does muscle generate heat? ...
  23. sociology

    Imagine a society in which there are no social classes- no differences in people’s wealth, income, and life chances. What would such a society be like? Would it be stable or would its social structure change over time? How could you apply Max Weber’s theory to this ...
  24. A&P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? 1A. What is its mRNA nucleotide sequence? AGCCCGAUGUUUUGUUUAGUUGCCCCGAGCGUUUGUUUAUUUGCC 1B. Indicate the product of this DNA segment/...
  25. biology

    Why do bamboos have leaves that encircle the stem? (Is it for some kind of structure support?) Also, why are there leaves at the top of the plant on lateral branches? There is graffiti at the base of some of the bamboo shoots. Why doesn't the graffiti grow higher up the shoot ...
  26. biology

    Why do bamboos have leaves that encircle the stem? (Is it for some kind of structure support?) Also, why are there leaves at the top of the plant on lateral branches? There is graffiti at the base of some of the bamboo shoots. Why doesn't the graffiti grow higher up the shoot ...
  27. Math

    An artist is designing the rectangular wire structure with four rectangles drawn inside. The artist has a 12 meter length of wire. If the entire area of the figure is to be maximized, what should be the length of X? I know the formula for area of a rectangle 2(x + y) but, the ...
  28. english

    Which of the following correctly defines blank verse? A. poetry with no structure or rhyme B. a type of long poem often used for plays C. a type of rhymed poetry Shakespeare uses throughout his plays D. unrhymed verse written in iambic pentameter i think it's A
  29. business english

    1.which of the following sentences is accurate in terms of the words it uses? a. there is alarge amount of people at the convention. b. we have to decide between the four options available to us. c.fewer people will attend the conference this year because of the higher costs. ...
  30. Physics

    1)Put the types of radiation of the electromagnetic spectrum in order from: a)longest to shortest wavelength b)greatest to lowest energy c)slowest to fastest speed A)radio,microwave,infrared,light,x-rays,gamma rays B)gamma-rays,infrared,light,microwave,radio I couldn't find C...
  31. Astronomy

    If a space probe were sent into orbit around the sun that brought it as close as 0.5 AU to the sun and as far away as 5.5 AU, what would its orbital period be? Can I use Kepler's 3rd law for this? I'm not sure how to take into account both AUs...
  32. DeskToping

    If you press the ______ key , you will jump to the previous screen. A. Page Down B. Page Up C. Home D. End I got C. You should _______ insert a blank space before the percent symbol. A. always B. not C. occasionally D. NONE OF THE ABOVE I got B.
  33. writeteacher

    i was advise not to take eng 093 just yet which is basic english and and the courses i take requires me to write papers. Please help me with learning the basics of english, like putting the commas, semi in its apprioate space. also grammar!
  34. writing

    i was advise not to take eng 093 just yet which is basic english and and the courses i take requires me to write papers. Please help me with learning the basics of english, like putting the commas, semi in its apprioate space. also grammar!
  35. Physics :(( help please TT

    The space shuttle had a top orbital speed of 8000 m/s and orbited in a circular orbit approximately 320 km above the earth's surface. How long was one orbit in seconds? Details and assumptions The radius of the earth is 6370 km.
  36. From theory and practice

    The major emphasis of movement programs for young children is the development of concepts. Which of the following three major categories are they broken into? A. What, who, and where B. Movement, skill, and fitness C. Awareness, knowledge, and understanding D. Body, space, and...
  37. Math

    Alex made a sketch for a homemade soccer goal he plans to build. The goal will be in the shape of a triangular prism. The legs of the right triangles at the sides of his goal measure 4 ft and 8 ft, and the opening along the front is 24 ft. How much space is contained within ...
  38. Literature

    PART A: What is Asimov's main idea in this essay? (Science an the sense of wonder) A- space is best appreciated through poetry B- poetry and science can work together****** C- the universe is more than beauty D- scientific knowledge is always advancing Help please!
  39. STATISTICS

    A3. A Retailing Entrepreneur sells sophisticated running shoes whose weights are assumed to be normally distributed with a mean of 12 grammes and a standard deviation of 0.5 grammes. (a) What is the probability that a shoe weighs more than 13 grammes? [3] (b) What must the ...
  40. College Statistics

    How much should you invest each month in order to have $800,000 if your rate of return is 5.3% compounded monthly and you want to achieve your goal in 40 years? How much interest will you earn? How much should you invest each month in order to have $800,000 if you want to ...
  41. physics

    a person is pulling a 100 lb box across a smooth horizontal surface. what is the acceleration of the box if they are pulling upward at an angle of 20° with a force of 75 lbs Well, I know that there is no friction involved because it is a smooth surface and that n+TsinΘ-...
  42. Relative Extrema: AP Calculus

    Consider the function f(x)= (3/4)x^4-x^3-3x^2+6x Find the relative extrema for f(x); be sure to label each as a maximum or minimum. You do not need to find function values; just find the x-values. Determine the interval(s) where f(x) is increasing (if any) and the interval(s) ...
  43. Physics

    Just as no mechanical device can be 100% efficient, no heat engine can transfer 100% of its heat to a single object. Some of the heat energy must be wasted (released into the environment). We have a heat engine that produces 150 J of heat, does 40 J of work, and emits 110 J ...
  44. CHEMISTRY HELPPPP!!!!!!!!!

    Consider the decomposition of NH3 (g). 2 NH3 (g) → N2 (g) + 3 H2 (g) The reaction is catalyzed on a surface of either tungsten or osmium. The activation energies for the catalyzed and uncatalyzed reactions are given below. W Ea = 163 kJ/mol Os Ea = 197 kJ/mol No catalyst...
  45. Physics

    One mole of tungsten has a mass of 184 grams, and its density is 19.3 grams per cubic centimeter, so the center-to-center distance between atoms is 2.51×10-10 m. You have a long thin bar of tungsten, 2.2 m long, with a square cross-section 0.16 cm on a side. You hang the rod ...
  46. Chemistry

    Element X has a face-centered cubic unit cell structure. If the density of the element is measured to be 12.4 g/cm^3, what is the atomic radius of X? units are in pm (picometers) I can't seem to find how to get the atomic radius with only the density given for an unknown ...
  47. chemistry

    The observation for three materials shows: Material A absorbs all the visible light (opaque) Material B is transparent to all the visible light (transparent) Material C absorbs blue light but is transparent to red light. (Blue light has wavelength 0.4 m, red light has ...
  48. chemistry

    The observation for three materials shows: Material A absorbs all the visible light (opaque) Material B is transparent to all the visible light (transparent) Material C absorbs blue light but is transparent to red light. (Blue light has wavelength 0.4 m, red light has ...
  49. physics

    The observation for three materials shows: Material A absorbs all the visible light (opaque) Material B is transparent to all the visible light (transparent) Material C absorbs blue light but is transparent to red light. (Blue light has wavelength 0.4 m, red light has ...
  50. Math

    The observation for three materials shows: Material A absorbs all the visible light (opaque) Material B is transparent to all the visible light (transparent) Material C absorbs blue light but is transparent to red light. (Blue light has wavelength 0.4 m, red light has ...
  51. Math

    how much space do sleeping quarters take if the sleeping quarters are for 100 guests and average density of the sleeping quarters are 15kg/m2
  52. Chemistry(Please check answers)

    1) The decomposition of hydrogen peroxide in solution and in the presence of iodide ion was studied in laboratory, and the following mechanism proposed based on the experimental data. H2O2 + I - = H2O + IO - (slow) H2O2 + IO - = H2O + O2 + I - (fast) Which one of the following...
  53. Mathematics

    a retailing entrepreneur sells sophisticated running shoes whose weights are normally distributed with mean of 12 grams and a standard deviation of 0,5 grams. (a) what is the probability that a shoe weighs more than 13 grams (b) what must be the standard deviation of weight be...
  54. Question

    Is this sentence punctuated correctly? After he began the meeting, he said,"I am going home." There needs to be a space between the comma after "said" and the opening quotation marks. Other than that, the sentence is fine. =)
  55. Space Science

    Which objects in the solar system have been least modified since the formation of the solar system? a)asteroids b)Kuiper Belt objects c)meteoroids d)terrestrial planets e)jovian moons
  56. Physics

    Please show steps and thank you! An astronaut of mass 70 kg carries an empty oxygen tank of mass 14 kg. He throws the tank away from himself with a speed of 3 m/s. With what velocity does the astronaut start to move through space?
  57. earth space science

    Potassium-40 has a half-life of approximately 1.25 billion years. Approximately how many years will pass before a sample of potassium-40 contains one-sixteenth the original amount of parent isotope?
  58. pop

    If superman in space throws a boulder with 10 times as much mass as himself, and the boulder leaves his hands at 100 m/s, how fast does superman recoil? A) 1000 m/s. B) The same speed, 100 m/s. C) 10 m/s. D) None of these are correct.
  59. math

    Assume that the box contains 5 balls: 1 yellow, 2 green, and 2 red. Balls are drawn in succession without replacement, and their colors are noted until a yellow ball is drawn. Q: How many outcomes are there in the sample space?
  60. Geo math

    Some flowers are being planted in a circular flower bed with a 10-foot diameter. If each flower requires 5 square feet of space, about how many flowers can be planted? What formula do I use to solve this?
  61. college physics 2

    steel train rails are placed end to end with space in between on a day where a temperature is 30 degrees. How much stress will be build if the temperature is increase to 150 degrees .assume that the original is 1.5m
  62. Math

    A cabinet has shelves that are 12 1/2 in. apart. On one shelf, Katherine stacked a CD player that is 4 5/8 in/ high on top of an amplifier that is 6 3/4 in. high. How much space was left above the CD player? I got 1 1/4; I added 6 3/4 and 4 5/8 and got 11 2/8. Then I ...
  63. Physics

    A proton is initially at rest in empty space, when suddenly an electric field of magnitude 8.0 x 10 4 n/c and direction due east is turned on. what is the magnitude and direction of the initial acceleration of the proton? Repeat the problem, but with an electron.
  64. Chemistry - Lewis Structures (check + help)

    I am asked to draw lewis strcutures of the following molecules and ions SF6, BrF5, XeF4, PF5 and IF4-. I have to follow a specific format to draw them, below is an example of SF6, where am i going wrong in the table, since i am not getting six bonds, nor am i successful with ...
  65. physics

    Three conducting loops are situated side-by-side in the plane of the page. A clockwise current flows in the center loop B, and its magnitude is decreasing in time. The induced currents in loops A and C: flow in opposite directions (A clockwise, B counterclockwise) both flow ...
  66. magnetism

    Three conducting loops are situated side-by-side in the plane of the page. A clockwise current flows in the center loop B, and its magnitude is decreasing in time. The induced currents in loops A and C: A) flow in opposite directions,A clockwise, B counterclockwise) b)both ...
  67. economics

    essay on staff apraisal in an organisation What kind of organization? Large, small? Profit-making or non-profit? What are the duties of the staff? Who does the appraisals? What criteria does the appraiser use? Efficiency? Use of time? Cordial relations with other staff members...
  68. Science

    I need some ideas for a science project on animal cells. For each structure I need to find an everyday object which has a similar job or function as that cell part. For example, the nucleus is like a brain. My list includes Lysosome, Golgi Body, Nucleolus, Mitochonrion, ...
  69. English

    They sustained life threatening injuries in the forest fire, their names, ironically, are included on the list of suspected arsonist. How would you correct the sentence structure error? a. separate the two clauses with a colon b. join the two independent clauses with a ...
  70. Calculus

    Consider the function f(x)=3cosx−cos^(3)x for 0<x<2π. For the following questions, write inf for ∞, -inf for −∞, U for the union symbol, None if no answer exists, and separate by a comma if more than one answer exist. a.) The x-intercepts are...
  71. Science

    This graph shows the changes in two populations of herbivores in a grassy field. In the y axis it says number of organisms in the x- axis it says Time In the graph A is decreasing , B is increasing, At first they were steady then slightly A decreased and B increased . A ...
  72. Physics!

    A person is standing on a 10-m bridge above a road. He wants to jump from the bridge and land in the bed of a truck that is approaching him at 30 m/s. In order to clear the bridge railing, he has to jump upward initially with a speed of 5 m/s. How far away should the truck be ...
  73. Heath help Plz--5 questions

    1. A percentile rank represents the percentage of people who scored at or below the test score. True** False 2. People who have high resting heart rates usually have high levels of cardiovascular fitness. True ** False 3. Resting heart rate is usually measured when you awake, ...
  74. Health--check my answers

    1. A percentile rank represents the percentage of people who scored at or below the test score. True False 2. People who have high resting heart rates usually have high levels of cardiovascular fitness. True False 3. Resting heart rate is usually measured when you awake, ...
  75. PHS 105

    At a particular instant, two asteroids in inter-stellar space are a distance r = 20 km apart. Asteroid 2 has 10 times the mass of asteroid 1, m2 = 10 m1. 1. If the acceleration of the asteroid 1 toward the asteroid 2 is 1.0 m/s2 , what is the acceleration of the asteroid 2?
  76. Physics

    What is the Earth's gravitational force on you when you are standing on the Earth and when you are riding in the Space Shuttle 380 km above the Earth's surface? Answer as a fraction of the surface gravity of Earth. (The Earth's radius is 6400 km.)
  77. math

    The function M(x)=-0.287x^3+8.8^2-59.843x+220.7 describes the incidence of measels (per 100,000) for the period 1940-1960 (x=0 for 1940). In what year was the greatest incidence of measels reported? According to the definition of M (x), what is the y intercept?Identify periods...
  78. biology

    any type'a study to work on this stuff? I just need to memorize it in order 2 get it 'cuz I don't forget and not answer it correctly. any type'a study to work on this stuff? I just need to memorize it in order 2 get it 'cuz I don't forget and not answer it correctly.>> ...
  79. early childhood education

    Which one of the following is probably not one of the reasons that circle times fail? a. The space was large and open b. The songs were repeated daily. c. The time period lasted too long. d. The teacher read a chapter book, hoping to encourage the children to excel.
  80. science`

    When doing an experiment, it is important to follow all of the procedures EXCEPT ______________. Question 1 options: wearing protective goggles arranging and organizing the work space neatly understanding the meaning of the safety precautions using smaller beakers before using...
  81. physics

    The speed of a space shuttle is 3.2×10^6 cm/s. Convert this into miles per hour (mph) using only 12 inches/ft, 60 seconds/min, 60 minutes/hour, and 1 inch = 2.54 cm. Factor Analysis must be used. Express your result to three significant digits and in scientific notation.
  82. Honors Biology

    For my class, we have to create a poster comparing the structure of an animal cell to something in real life. Our teacher told us we're not allowed to use a factory, aquarium, or a car as our example. I thought of a school, but I want other ideas to work with also, but I can't...
  83. biology honors

    Why do leaves tend to be flat.choices a.so that water can easily be absorbed and carried to the rest of the plant. B.so that sunlight can easily penetrate to the leafs photosynthetic tissues. C.so that nutrients can easily enter the plant and be be used for structure and ...
  84. Ancient Greece

    How did ancient greek philosophers such as Plato and Aristotle contribute to the formation of modern democratic governments? a. by contemplating the purpose and structure of government b. by encouraging the participation of all citizens in governance c. by prescribing civil ...
  85. Sociology

    In America, the family of the 1950's (young, married, two children, father works while mother stays at home) is often idealized. What social factors caused that family structure to exist and why is it less common today? I can't seem to think of any factors.. can someone please...
  86. Economics

    A long-run supply curve is flatter than a short-run supply curve because A. firms can enter and exit a market more easily in the long run than in the short run. B. long-run supply curves are sometimes downward sloping. C. competitive firms have more control over demand in the ...
  87. Language Arts -- Compare & Contrast Essay

    Hi I'm back. I don't really known how to structure the introduction and the conclusion of a compare & contrast essay. I know you have to state the thesis twice, but what form are you supposed to generally follow when writing the intro and conclusion of this type of essay? Thanks
  88. math for teachers

    John is building bookcase 73 3/8 inches tall, he wants 5 shelves equally spaced. Where does he drill holes (space between shelf)? Shelf is 3/8 inch thick. Do I add 3/8 for top and bottom? or is shelf 5 bottom? I do not have a clue.
  89. Math

    Find the sample space. a Bag contains 4 marbles: one each of red, blue, green and violet. Two marbles are drawn from the bag. assume that the first marble is not put in the bag before drawing the second marblle
  90. Chemistry

    Water does not easily remove grease from dirty hands because grease is nonpolar and water is polar; therefore they are immiscible. The addition of soap, however, results in the removal of the grease. Examine the following structure of soap and explain why soap works. O || CH3(...
  91. cary = English

    Please look at how Rosetta Stone sets up the learning, including pictures, etc. Note how the "recall" is done. Then you will understand better how to structure y our class: http://www.rosettastone.com/ Sra
  92. chemistry

    Name the compound (CH3)2CHCCCH3 1. 2-methyl-3-pentyne 2. 3-methyl-1-pentyne 3. 5-methyl-2-pentyne 4. 4-methyl-2-pentyne 5. 3-methyl-2-hexane 6. 4-methyl-2-pentene Can you also explain how to draw the structure? Thanks:)
  93. English II

    "Base Details" If I were fierce, and bald, and short of breath, I’d live with scarlet Majors at the Base, And speed glum heroes up the line to death. You’d see me with my puffy petulant face, Guzzling and gulping in the best hotel, Reading the Roll of Honour. Poor young ...
  94. English II

    "Base Details" If I were fierce, and bald, and short of breath, I’d live with scarlet Majors at the Base, And speed glum heroes up the line to death. You’d see me with my puffy petulant face, Guzzling and gulping in the best hotel, Reading the Roll of Honour. Poor young ...
  95. information literacy

    1. which article title represents a citation under the news results? A)priceton paleontologist produces evidence for new theory on dinosaurs extinction B)chunk of death dealing with astroid found C)second crater points to killer comets D)extinctions tied to impact from space
  96. ap chemistry

    there's a few questions I have...actually it's a bit more than a few... 1. Identify the carbon atom(s) in the structure shown that has (have) each of the following hybridizations: a. sp3, b. sp, c. sp2 N*triplebond*C-CH2-CH=CH-CHOH | CH=O | H 2. Draw all the possible noncyclic...
  97. waste water treatment

    Wastewater from a small town is treated in a trickling filter which is preceeded by a screen, sand-removal and primary clarification. The maximum hydraulic capacity, or peak flow, of the treatment plant is 1,500 m3/h. The dry weather flow (Qdwf) amounts 7,500 m3/day, with a ...
  98. English

    Replace the underlined portion or leave it. 1. The study of Kenya's history as a colony will help you see how colonialism works and thus understand how destructive it was to the people were colonized. Underlined portion: people were a. no change b. people what were c. people ...
  99. math

    A foyer is 8 feet by 8 feet the tiles are 4 square feet how many tiles will fill the space
  100. math

    a toy car store is ordering 3,000 remote control cars.the store can order the cars in sets of 10.how many sets of 10 does the store need to order? a.30 b.300 c.3,000 d.30,000 a.what information do you need to use? b.what do you need to find? c.how can renaming numbers help you...
  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. 16
  18. 17
  19. 18
  20. 19
  21. 20
  22. 21
  23. 22
  24. 23
  25. 24
  26. 25
  27. 26
  28. 27
  29. 28
  30. 29
  31. 30
  32. 31
  33. 32
  34. 33
  35. 34
  36. 35
  37. 36
  38. 37
  39. 38
  40. 39
  41. 40
  42. 41
  43. 42
  44. 43
  45. 44
  46. 45
  47. 46
  48. 47
  49. 48
  50. 49
  51. 50
  52. 51
  53. 52
  54. 53
  55. 54
  56. 55
  57. 56
  58. 57
  59. 58
  60. 59
  61. 60
  62. 61
  63. 62
  64. 63
  65. 64
  66. 65
  67. 66
  68. 67
  69. 68
  70. 69
  71. 70
  72. 71
  73. 72
  74. 73
  75. 74
  76. 75
  77. 76
  78. 77
  79. 78
  80. 79
  81. 80
  82. 81
  83. 82
  84. 83
  85. 84
  86. 85
  87. 86
  88. 87
  89. 88
  90. 89
  91. 90
  92. 91
  93. 92
  94. 93
  95. 94
  96. 95
  97. 96
  98. 97
  99. 98
  100. 99
  101. 100