Rank the crystal lattice structures in order of decreasing efficiency of space in the structure.

20,916 results, page 67

  1. government

    factors contributing to the failure of minor parties to win much support in the united states include a. the electoral system b. the number of independent voters c. the loose structure of political parties d. the pluralistic society of the united states a
  2. sentence structure

    which conjunction word would best combine the two sentences together. then or until. i would prefer "until" is that ok For centuries people ate with their hands. A change finally occured in the 1100's when people used utensils.
  3. Structure of the Earth

    What severe conditions make the rock of the asthenosphere to behave like a fluid? The pressure builds down from the lithosphere onto the asthenosphere causing it to act like a viscous fluid, or soft plastic. Is this a complete answer?
  4. child development

    Older children write better than younger children because ? A.they are they have less knowledge about the world. B.they have the mechanical aspects of writing. C.they organization their writing as they retrieve itb,often with an obvious structure. The answer is b
  5. algebra

    true or false? A Aquarium which is 4ft x 5ft x 3ft high can hold 800 gallons of water. (assume that one cubic foot of space holds 7.5 gallons of water)
  6. college physics

    The space shuttle releases a satellite into a circular orbit 550 km above the Earth. How fast must the shuttle be moving (relative to Earth) when the release occurs?
  7. ALGEBRA

    Suppose it takes 3 days for a space vehicle to travel from the Earth to the moon. About how long would it take the same vehicle traveling a the same speed to reach Neptune?
  8. algebra 1

    there are 5 rows of pictures with 3/16 inch of vertical space between pictures.Draw a diagram and label all the heights on your diagram then write and solve an equation to find the height of each picture
  9. early childhood development

    the basis of a good child guidance system is the caregiver's (a)arrangement of space in the facility (b)kknowledge of child development (c)choice of equipment (d)schedule of activities i put b
  10. chem

    The average distance between planet X and Earth is about 1.5 x 10^8 miles. How long (minutes would it take pictures transmitted from a space vehicle on Planet X's surface to reach Earth?
  11. Physics

    Explain why a rapidly spinning gyroscope, mounted in a frame that allows it to rotate in any direction independently of the frame’s rotation, tends to maintain its axis pointed in the same direction in space.
  12. Chemistry

    How many moles of lithium carbonate are contained in 400 mL of a lithium carbonate solution with a concentration of 0.015 mol L-1? Give your answer as two sig. figures, followed by a space and the units
  13. physics

    An electron moving to the right at 4.0% the speed of light enters a uniform electric field parallel to its direction of motion. If the electron is to be brought to rest in the space of 5.0 cm, determine what the strength of the field is.
  14. Cosmology

    Which of the following phenomena is NOT a consequence of Special Relativity? - Mass-energy curves space-time - Length contraction - Time dilation - Mass can not travel faster than the speed of light
  15. Math

    About. 7.5 gallons of water filled up 1 cubic foot of space. How many gallons of water will fill a goldfish pool shaped like the prism shown. 3 ft for length 3.5 ft for width 1.5 ft for height
  16. Physics

    An astronaut throws a ball with mass m to the right with speed v. It strikes the wall of the space station and rebounds, moving left with a speed V/2. What was the magnitude of the impulse of the ball caused by the collision?
  17. College Algebra

    You have a credit card with a balance of $3000. Each month the minimum payment is 2.5% of the balance. The monthly interest rate is 1.5% of the balance. You decide you would like to pay off this card by making the minimum payment each month. You cut up the card so that you ...
  18. Science HELP PLZ

    1. Which type of eclipse would you expect to see if the moon passes directly between Earth and the sun? (1 point) a solar eclipse* a lunar eclipse a total lunar eclipse a penumbra 2. Which of the following statements about a lunar eclipse is true? (1 point) A lunar eclipse can...
  19. physics help

    At a certain location, the solar power per unit area reaching the Earth's surface is 180 W/m2 averaged over a 24-hour day. Suppose you live in a solar powered house whose average power requirement is 3.2 kW. At what rate must solar energy reach your solar panels if your solar ...
  20. physics

    At a certain location, the solar power per unit area reaching the Earth's surface is 180 W/m2 averaged over a 24-hour day. Suppose you live in a solar powered house whose average power requirement is 3.2 kW. At what rate must solar energy reach your solar panels if your solar ...
  21. lanquage arts

    how do you write a timeline Timelines are dates and events written in chronological order. Some timelines allot the same amount of space between years, decades, or centuries. Others just list the dates and events with no regard to proportionate spacing. This Web site will help...
  22. computer science

    Describe how an operating system that uses paging could make stacks grow dynamically if the original size proves too small. What would the page table data structures look like? Explain what would happen when a thread's stack grows past the area that has been allocated for it (...
  23. statistics

    Below are the top 20 U.S. football teams in the seventh and eighth weeks of the 2003 season, along with the points awarded to each team by the ESPN/USA Today coaches poll. Research question: At á = .01, based on this data, is there a significant rank correlation between these...
  24. comp.sci-python

    For this option, first ask the user what the maximum number of columns for printing will be. ("How wide should the output be?") Next, the user will enter in a paragraph of text. They may enter it in as many lines as they'd like, and the only way you know they are done typing ...
  25. Criminal Justice

    During the 1960s, social structure theories strongly influenced the development of delinquency prevention programs. Why did many of the earliest programs fail? What is being done differently today in the development of prevention programs?
  26. Chemistry

    In the Lewis structure for SF4, there are: a. 12 electrons surrounding the S. b. 10 electrons surrounding the S c. a total of 42 valence electrons. d. Both a and c are correct. e. None of the above are correct
  27. business math

    Question: You receive the results of a paired-comparison preference these of four soft drinks from a sample of 200 persons. The results are as follows: Koak Zip Pabze Mr.Pep Koak ---- 50 115 35 Zip 150 --- 160 70 Pabze 85 40 --- 45 Mr.Pep 165 130 155 --- a). How does these ...
  28. geometry

    h ttp://img64.imageshack.us/img64/574/plotformula.jpg (please remove the space in the link above, because I could not post the full problem) I think that I should use the following: a<b+c ,b<a+c ,c<a+b or the inequality of the means, but I have no idea how to do it.
  29. Phizzics....

    n 2005, the space probe Deep Impact launched a 30 kg projectile into Comet Tempel 1. Observing the collision helped scientists learn about the comet’s characteristics. The come is estimated to have a mass of 9.0 x 1013 kg.
  30. Physics 1 College Level

    If D = 3204 meters and d = 1247 meters in the figure, what is the magnitude of the force on the space ship to the nearest MN? Consider all three to be point masses. I'm not even sure to begin with this question. Any help will be much appreciated!
  31. planning & implementing for the environment

    Which of these factors is most likely to determine the total number of children you can take into your facility? A.Children's needs B. physical space available C. Program philosophy D. Staff members skills My answer is B
  32. Antennas

    The GSM-900 (900MHz band) link budget allows a maximum isotropic path loss of 143 dB (the antenna gains are not included). Which is the corresponding maximum cell radius for undistributed free space propagation?
  33. physics

    a child sees an empty soda can resting on the icy surface of a frozen pond and throws a stone at it the stone hits the can which then slides across the ice decreasing in speed as it does so at the edge of the pond the can hits a pile of snow and stops which of the following ...
  34. Math

    The school handy man measured the space needed for a new computer monitor in the science room at 20 3/4 inches. Which of these measures is NOT more precise? A. 20 1/2 inches B. 20 7/8 inches C. 20 15/16 inches D. 20 21/32 inches
  35. Science

    1. Which type of eclipse would you expect to see if the moon passes directly between Earth and the sun? (1 point) a solar eclipse* a lunar eclipse a total lunar eclipse a penumbra 2. Which of the following statements about a lunar eclipse is true? (1 point) A lunar eclipse can...
  36. math

    *This is orders of magnitude* 1)So, I have to estimate 16,700,000,000,000,000 the product of a single digit of 10. - 2 x 10^16 - 2 x 10^15 *my answer* - 1 x 10^16 - 1 x 10^15 2)0.00000394 estimated as the product of a single digit. ____ x 10____ *fill in the blanks* *my answer...
  37. Chem Help Please!!!

    Experiment Design You are asked to separate a mixture of toluene and cyclohexane. Assume that they do not form an azeotropic mixture. Design an experiment to do this. You must provide the following information. a) A diagram of the equipment you will be. b) What distillate ...
  38. Physics

    Which of the following statements about Ohm’s Law is true? A. Keeping the same voltage and decreasing resistance decreases the current. B. To increase the current, decrease the resistance. C. Ohm’s law relates power, current and resistance. D. Increasing the voltage ...
  39. Order of Operations

    7/6+(10-4)x5 35?
  40. science,

    1,3,5,2 ORDER IT
  41. Check please science

    Cells are to tissues as organs are to 1 ORGAN SYSTEM 2 CELLS 3 GENES 4 ORGANELLES IS THE ANSWER 1 ORGAN SYSTEM Which of statements about cells is not true? 1. One or more cells make up all living organisms 2 cells carry on the basic life functions of living organisms 3 cells ...
  42. Early Child Ed.

    Would you please check these questions and my answers? If they are wrong-- please let me know. 1. Early childhood professionals know that the beginning step in assisting non-mainstream children to develop literate style oral language is to: A) identify receptive and expressive...
  43. english

    Which sentence shows correct punctuation of an introductory structure? When I ran across the tile I lost my balance and slipped. If I had stayed late on Friday, I could have caught up on my work. Well I delivered the memo to Mr. Jenkins last week. Miriam ran the copies, and ...
  44. Grammar, sentence structure

    "Yesterday was Aldo’s 15th birthday, friends and relatives travelled half a hundred miles by horse from the grand streets of Rome to have a dinner party." I'm having a very bad time structuring this sentence correctly so it can flow easily when speaking. Please help!
  45. Human Physiology...Please Help

    Sensory Physiology Pick two types of sensory receptors: A. Pick two different modalities that would stimulate them B. Put these modalities in order with respect to adequate stimulus So if i was to pick, Photoreceptors and Thermoreceptors ( these would be the sensory receptors...
  46. English

    Playing the dice game, have a conversation about what you must do and what you must not do at each place. After that write down the rules as in the example. You should work in pairs. One should roll the dice and according to the number on the dice, he should move the marker. ...
  47. Science

    When it was first classified by biologists, the elephant shrew was placed with the bicolored shrew in a cladogram. Since then, additional evidence has been found that caused scientists to remove the elephant shrew from the shrew group and place it in a new position in a ...
  48. Science

    When it was first classified by biologists, the elephant shrew was placed with the bicolored shrew in a cladogram. Since then, additional evidence has been found that caused scientists to remove the elephant shrew from the shrew group and place it in a new position in a ...
  49. Chemistry (geometric)

    Calculate the number of cations anions, and formula units per cell unit of the following : rock-salt structure, and flourite....I have no idea how to do the second one but for the first one I got 13, 14, and 13.5 respectively. Also, what are the coordination numbers of the ...
  50. A and P

    The following is a template strand of DNA with a start codon(=!!!) and a stop codon(=???): !!!TCGGGCTACAAAACAAATCAACGGGGCTCGCAAACAAATAAACGG??? What is its mRNA nucleotide sequence? Indicate the product of this DNA segment/gene. What is the product’s primary structure? How ...
  51. child development

    -----------are considered critical at certain times during early growth and development and have growth-inducing influence on the brain's structure. A) Growth spurts B)Norms C)Essential experiences D)Nonessential experiences
  52. Check my answers? (Chemistry)

    I only get one chance for each of these questions so I was wondering if someone could check my answers, thanks! 1. Consider the following reaction at equilibrium. 2 BrNO(g) ---> 2 NO(g) + Br2(g) Predict the effect of the following changes to the reaction mixture. (a) adding...
  53. Science

    1. Which type of eclipse would you expect to see if the moon passes directly between Earth and the sun? (1 point) a solar eclipse* a lunar eclipse a total lunar eclipse a penumbra 2. Which of the following statements about a lunar eclipse is true? (1 point) A lunar eclipse can...
  54. accounting

    2. Final Project: Business Plan Resources: Appendix A Due Date: Sunday Day 7 [Individual] forum Write a 700- to 1,050-word paper, using APA guidelines, based on the scenario below. You want to start your own business. You found an investment group that is willing to give you ...
  55. CAL-Help on dr/dt

    A circular oil slick of uniform thickness is caused by a spill of 1 cubic meter of oil. The thickness of the oil is decreasing at the rate of 0.1 cm/hr as the slick spreads. (Note: 1 cm = 0.01 m.) At what rate is the radius of the slick increasing when the radius is 8 meters...
  56. chemistry

    water: describe how its molecular structure is responsible for its ability to serve as a solvent for salts and other ionic or polar materials. Explain how you can be sure it isn't a straight molecule? Is it because hydrogens can come off a attach to other things? I don't know ...
  57. civics

    Libertarians believe that individual liberty is very important.They believe that people have the right to engage in any activity that is peaceful and honest. They also support a limited government and elimination of income tax. On which of the following issues would Democrats ...
  58. socials

    i writing paragraph on whether the first nations within canada be granted some form of self government with the regard to their economy, education, laws, and environment? i have to give evidence to back my claims. i not sure if this good idea because if they have self ...
  59. Social Studies

    At home on the hills of Vermont or in the woods of Maine, or the Texan ranch, comrade of Californians, comrade of free North-Westerners. . . . of every hue and caste am I, of every rank and religion. --Walt Whitman, Song of Myself Why did Whitman compose these lines? A. To ...
  60. physics

    At what speed should a space probe be fired from the earth if it is required to still be traveling at a speed of 3.48 km/s, even after coasting to an exceedingly great distance from the planet (a distance that is essentially infinite)?
  61. To:BobPursley

    Earlier you told me "hold a pencil up. A real pencil. I bet you can make perpendiculars in many directions, because the pencil is in a three dimensional space". Could you explain to me what do you mean by this? I try holding up a pencil and doesn't see anything.Thanks
  62. Earth/Space Science

    Some scientists have hypothesized that meteorites have periodically bombarded Earth and caused mass extinctions every 26 million years. How might this hypothesis be tested?
  63. College Algebra

    Let h(12) = -100 for some function h(x), defined everywhere. If the average rate of change of h(x) from x = 12 to x = 20 is 50, then find h(20). Type your numerical response in the space provided. Do not type in any of the processes which you utilized to arrive at your response.
  64. Math

    1. P5 is an innerproduct space with an inner product. We applied the Gram Schmidt process tot he basis {1,x,x^2,x^3,x^4} and obtained the following as the result {f1,f2,f3,f4,x^4+2}. a. What is the orthogonal complement of P3 in P5 with erspect to this inner product? b. What ...
  65. Chemistry

    What is the concentration, in mol L-1, of a solution containing 1.2 g of lithium carbonate in 100 mL solution? Give your answer as 2 sig fig, followed by a space and the units (remember the units given in a previous question).
  66. math

    A single card is selected from an ordinary deck of cards. The sample space is shown in the figure below. Find the probabilities. (Enter the probabilities as fractions.) (a) P(two of diamonds) 1 (b) P(two) 2 (c) P(diamond) 3
  67. physics

    if a monochromatic beam of light with a wavelength of 590 nanometers is traveling through air then enters a region of space where the index of refraction is 1.5, what will the light beam do? increase, decrease, or stay the same?
  68. Science

    A space probe on the surface of Mars sends a radio signal back to earth a t a distance of 8.66 x10*7 radio waves travel at a speed of light 3.00 x 10^8 . How many seconds does it take for it to reach earth
  69. math

    (a) In order to express the function y = 1010 x + 4, as a composition of two functions the outer of which is an exponential function, we would let u be equal to the inner function, u = , and then write y as a function of u, as follows: y = . (b) In order to express the ...
  70. science

    I've got a project due on Monday and i can't find any thing on what I'm supposed to be doing it on. I'm doing it on the chemical mixture of jelly and whenever i type that into Google it just comes up as like petroleum jelly and doesn't give me any answers. can anyone tell me ...
  71. chem please help

    What characteristic best describes the low entropy associated with solids? A. The atoms in a solid are mostly metals. B. The atoms are held together with strong bonds. C. The atoms are arranged in a rigid structure. D. The solid has a high specific heat capacity. I think c.
  72. Microsooft PP

    You're creating a table for one of your slides, and need to make some modifications to your table structure. Which of the following options can you perform by right-clicking inside the table? A. Create SmartArt B. Merge cells C. Invoke Excel spreadsheet D. Create a comment My ...
  73. Economics -- HELP!!!

    posted by Angela on Sunday, May 21, 2017 at 12:33am. In the market equilibrium, with a price of $500 there are 2000 apartments. If the government decides to enact a rent control policy, with a maximum price of $400, it reduces the quantity to 1500 apartments. Due to the rent ...
  74. Probability

    If I have a bag filed with 6 marbles, 2 blue marbles, and 4 yellow marbles, and I had to pick one from the bag, what is my sample space?
  75. Probability

    If I have a bag filed with 6 marbles, 2 blue marbles, and 4 yellow marbles, and I had to pick one from the bag, what is my sample space?
  76. Probability

    If I have a bag filed with 6 marbles, 2 blue marbles, and 4 yellow marbles, and I had to pick one from the bag, what is my sample space?
  77. Linear Algebra

    4 points A,B,C and D are situated in a 3-dimensional space. In a certain spot, the coordinates of A, C and D are known: A(1,1,1) C(2,0,1) D(0,3,0) The coordinates of the barycentre of {A,B,C} are: (4/3, 1/3, 4/3). a) Determine the coordinates of point B in the used spot.
  78. Linear Algebra

    4 points A,B,C and D are situated in a 3-dimensional space. In a certain spot, the coordinates of A, C and D are known: A(1,1,1) C(2,0,1) D(0,3,0) The coordinates of the barycentre of {A,B,C} are: (4/3, 1/3, 4/3). a) Determine the coordinates of point B in the used spot.
  79. Physics

    A spaceship in deep space has a velocity of 4000 km/s and an acceleration in the forward direction of 6 m/s2. What is the acceleration of a ball relative to the spaceship after it is released in this spaceship?
  80. PHYSICS

    A particle (mass = 5.0 g, charge = 40 mC) moves in a region of space where the electric field is uniform and is given by Ex = 2.5 N/C, Ey = Ez = 0. If the velocity of the particle at t = 0 is given by vy = 50 m/s, vx = vz = 0, what is the speed of the particle at t = 2.0 s?
  81. Chemistry

    How will the boiling point of a substance be affected by increasing the atmospheric pressure? How will the boiling point of a substance be affected by decreasing the atmospheric pressure?
  82. Math

    Am not good with story prombles could someone please help. Can you show me how to come up with answer so that I understand it. The bith rate in the United states in 1996 was 14.7 births per thousand population. In 2006, the birth rate was 14.14 births per thousand. A.Write two...
  83. Algebra (Need help desperately)

    I really don't understand these.. can someone show me the correct way of doing them? (if it helps I will pay over paypal for detailed help or will pay in my services (I am a graphic designer, video editor, and web designer) ************************************ 1. Your computer...
  84. Physics

    An astronaut in outer space pushes himself away from his spaceship. About how far does the astronaut go before stopping? What does the astronaut have to do to stop himself?
  85. Finite Math

    Let A and B be two events in a sample space S such that P(A) = 0.5, P(B) = 0.6, and P(A intersection B) = 0.15. Find the probabilities below. Hint: (A intersection Bc) union (A intersection B) = A. (a) P(A|Bc) ________ (b) P(B|Ac) ________
  86. Physics

    A particle (mass = 4.0 g, charge = 50 mC) moves in a region of space where the electric field is uniform and is given by Ex=3.0N/C. If the velocity of the particle at t=0 is given by vy=40 m/s, what is the speed of the particle at t=2.0 seconds?
  87. Math 7 (Q2)

    Cindy is making a punch for a party. The recipe calls for 3 bottles of cranberry juice in order to make enough punch to serve 40 guests. How many bottles of cranberry juice will Cindy need in order to make enough punch to serve 100 guests? Answer ___________ bottles so..... 3/...
  88. English

    I don't know what rhetorical devices these themes fall under. I know all these are themes but the themes are harder to figure out . 1. The value of dreams can be both a positive and be both a positive and negative influence. 2. It is important for men and women to play ...
  89. Math

    A car has a fuel efficiency of 33 miled per gallon.(a) Find a function G that calculates the number of gallons required to travel x miles. (b)If the cost of gas is $4 per gallon, find the function C that calculates the cost of fuel to travel x miles.
  90. Literacy

    The idea that countries should produce and sell goods that they produce most effectively and efficiently, and buy goods that other countries produce most effectively and efficiently, is known as A. absolute advantage theory. C. efficiency balanced trade. B. free trade. D. ...
  91. physics

    A car comes to a stop for a stop sign in 4.6 seconds. If it was initially traveling at 27.5 m/s, how much space did it take for the car to stop?
  92. Macro economics

    5. The problem of determining what goods and services society should produce: A.exists because we can produce more than we need or want. B.exists because there are not enough resources to provide all the goods and services that people want to purchase. C.would not exist if all...
  93. science

    Three very small spheres of mass 3.00 kg, 5.00 kg, and 3.00 kg are located on a straight line in space away from everything else. The first one is at a point between the other two, 13.0 cm to the right of the second and 24.0 cm to the left of the third. Compute the net ...
  94. math

    Two points, A and B, are 275 ft apart. At a given instant, a balloon is released at B and rises vertically at a constant rate of 2.5 ft/sec, and, at the same instant, a cat starts running from A to B at a constant rate of 5 ft/sec. a) After 40 seconds, is the distance between ...
  95. music

    i have to do a project about 'west end musicals' can anyone suggest how i structure his and what i should include because I don't know what to include. shall i include a page about a popular musical and so on or not? can anyone find any useful sites which I can refer to whilst...
  96. Physics

    Sorry for reposting this but I'm still confused with the last part... You have been sent in a small spacecraft to rendezvous with a space station that is in a low circular Earth orbit, say, with a radius of 6,720 km, approximately that of the orbit of the International Space ...
  97. Physics

    Sorry for reposting this but I'm still confused with the last part... You have been sent in a small spacecraft to rendezvous with a space station that is in a low circular Earth orbit, say, with a radius of 6,720 km, approximately that of the orbit of the International Space ...
  98. Calculus

    In the case of a decreasing, concave down parabola in the intervals 0 to 1 with all of the y values positive, would the actual area be less or more than the estimated area using the trapezoid rule? And would it be less or more than using the midpoint rule? I know the left ...
  99. math

    The average cost per item, C, in dollars, of manufacturing a quantity q of cell phones is given by C= (a/q) + b where a and b are positive constants a.Find the rate of change of C as q increases. What are its units? b. Currently, 5000 phones are being made and production is ...
  100. math

    The average cost per item, C, in dollars, of manufacturing a quantity q of cell phones is given by C= (a/q) + b where a and b are positive constants a.Find the rate of change of C as q increases. What are its units? b. Currently, 5000 phones are being made and production is ...
  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. 16
  18. 17
  19. 18
  20. 19
  21. 20
  22. 21
  23. 22
  24. 23
  25. 24
  26. 25
  27. 26
  28. 27
  29. 28
  30. 29
  31. 30
  32. 31
  33. 32
  34. 33
  35. 34
  36. 35
  37. 36
  38. 37
  39. 38
  40. 39
  41. 40
  42. 41
  43. 42
  44. 43
  45. 44
  46. 45
  47. 46
  48. 47
  49. 48
  50. 49
  51. 50
  52. 51
  53. 52
  54. 53
  55. 54
  56. 55
  57. 56
  58. 57
  59. 58
  60. 59
  61. 60
  62. 61
  63. 62
  64. 63
  65. 64
  66. 65
  67. 66
  68. 67
  69. 68
  70. 69
  71. 70
  72. 71
  73. 72
  74. 73
  75. 74
  76. 75
  77. 76
  78. 77
  79. 78
  80. 79
  81. 80
  82. 81
  83. 82
  84. 83
  85. 84
  86. 85
  87. 86
  88. 87
  89. 88
  90. 89
  91. 90
  92. 91
  93. 92
  94. 93
  95. 94
  96. 95
  97. 96
  98. 97
  99. 98
  100. 99
  101. 100