DNA-Repeats, strands

1,162 results

DNA-Repeats, strands

If one strand of a segment of double-stranded DNA is tandemly repeating, the complementary strand will consist of interspersed repeats, tandem repeats, same sequence in reverse order, or not enough info to decide?

dna strands/sequences

The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut by EcoR1? I. TTCAGGAATTCGGAAACC AAGTCCTTAAGCCTTTGG II. TGAATCGAACCTG ACTTAGCTTGGAC III. TTAAGCGGCCGAATTCAGTCCA AATTCGCCCGCTTAAGTCAGGT IV. CAGTAGGATTTCTGTGTC GTCATCCTAAAGACACAG I and ...

Biology

Which of the following is true about DNA? It is a single-stranded molecules Only one of the original DNA strands acts as a template during replication. Both of the original DNA strands act as templates during replication. Its replication takes place in the cytosol.

Biology

Kay so these are the strands of DNA 5' C C A G T A G T T 3' 3' G G T C A T C A A 5' Let's say the DNA molecule above were the parent strand of DNA. when the strands are split for replication, which strand would be the template for the leading strand? And can you also please ...

Biology

In DNA fingerprinting, the DNA probe that is used is ______to the DNA sequence of the repeats in the sample? im guessing amplify????

Science

In DNA fingerprinting, the DNA probe that is used is ______to the DNA sequence of the repeats in the sample? im guessing amplify????

Biology

16. During DNA replication, all of the following steps occur EXCEPT a. enzymes proofread new strands for errors and correct them b. the double helix is unwound by DNA polymerases c. base-pairing rules determine which nucleotide is added to new strands d. each strand of a DNA ...

DNA, strand, complementary

If one strand of a segment of double-stranded DNA is tandemly repeating, the complementary strand will consist of interspersed repeats, tandem repeats, same sequence in reverse order, or not enough info to decide? anyone have any ideas, tips? it is ... a|T C|G

science- DNA

Of all possible DNA nucleotide sequences, what sequence of base pairs would dissociate most easily into single strands if the DNA duplex were heated gently?

science

Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A or B. A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the correct DNA ...

BIOLOGY

WHEN A DNA MOLECULE IS COPIED TO MAKE ANOTHER DNA MOLECULE, WHICH STATEMENT BEST DESCRIBES THE RESULTING STRANDS? A. ONE DOUBLE STRANDED DNA MOLECULE IS THE ORIGINAL AND THE OTHER A NEW COPY B. BOTH RESULTING STRANDS ARE ENTIRELY MADE OF NEW DNA BASED ON THE INFORMATION IN AN ...

Science-important!

Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A or B. A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the correct DNA ...

science

Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...

Biology

Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...

Science

mismatch error to be repaired? Which is the best answer, I think it's A. Can someone who know's science tell me if I am right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...

Biology (check answer)

Transcription is similar to DNA replication in all of the following ways except: a) the DNA strands unzip b) the polymerase enzyme is involved c) complementary bases are paired up d) a new strand of mRNA is built from the existing DNA molecule is it d?

Biology

14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of the above D 16. During DNA replication, all of ...

Science

Does anyone have any suggestions on where I might find the answers to my question? I have tried several different ways, but have not been successful. I think if I find the first one, I will find the others. If you have two strands of DNA, how many new DNA molecules will form ...

genetics

What is a replication bubble? A.A complex of replication enzymes on the DNA template strand B.A DNA sequence that initiates replication C.A tangle of denatured DNA strands near the replication fork D.A locally denatured segment of DNA where replication originates E.A localized...

Biology

14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of the above D? 16. During DNA replication, all of ...

Biology-Is my answer correct

Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...

Science

After replicated a DNA molecule with two strands three times, how many molecules of DNA are formed? Is eight the correct answer?

Biology

What is the name of the protein that breaks the hydrogen bonds in the double helix causing the DNA strands to separate during DNA replication? I have a test tomorrow so please help!

psychology

Which one of the following statements describe the relationship between genes,chormosomes and DNA? A genes,the basic unit of heredity,are located on chromosomes,which consist of strands of DNA B genes are composed of chromosomes and Dna C chromosomes,tha basic unit of heredity...

psychology

Which one of the following statements describe the relationship between genes,chormosomes and DNA? A genes,the basic unit of heredity,are located on chromosomes,which consist of strands of DNA B genes are composed of chromosomes and Dna C chromosomes,tha basic unit of heredity...

Psychology

Which of the following statements describes the relationship between genes, chromosomes, and DNA? a. Genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA b. Genes are composed of and DNA c. Chromosomes, the basic unit of heredity, ...

Genes

Which one of the following statements describes the relationship between genes, chromosomes and DNA a) genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA b) genes are composed of chromosome and DNA C) chromosomes the basic unit if ...

genetics

The definition of transformation is: A.the shift of genetic information from DNA to protein. B.the recombination of DNA strands during meiosis C.the uptake of genetic information by a cell from the environment. D.the combining of DNA during fertilization. E.the changes caused ...

psychology

Which one of the following statements describes the relationship between genes, chromosomes, and DNA? a. Genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA.b. Genes are composed of chromosomes and DNA. c. Chromosomes, the basic unit ...

science

Of all possible DNA nucleotide sequences, what sequence of base pairs would dissociate most easily into single strands if the DNA duplex were heated gently?

chemistry

What types of linkage joins the nucleotides a) within a single DNA strand and b) between two single DNA strands?

biology

why is DNA semi-conservative? does it have something to do with two new strands are formed using the two molecules from the original DNA

biology

i have some notes but before christmas break was here i had surgery so i didn't get to finish my notes in class and i don't understand much of my work so heres part of my notes: DNA and RNA Differences: #of strands for DNA? RNA? sugar DNA? RNA? Base that binds with Adenine DNA...

help science

3 simple steps for DNA duplication I have found so many answers but cant get a concise one. 1. separation - of 2 dna strands unzips ? 2. duplicates ? 3. zips back up ? and then a simple sentence about each

biology

1. What are the three parts that make up a nucleotide? 2. What is the sugar found in DNA? 3. What are the four different bases found in DNA nucleotides? 4. What two parts make up the sides of the DNA “ladder”? 5. What holds the sugars and the phosphates together? 6. What ...

science please help

after the DNA strands are separated, which of the following is the next step of DNA replication in the S phase of the cell cycle? A) Action of helicase B) formation of RNA primer C) Breaking of hydrogen bonds D) joining of nucleotides i think it is either B or D

science please help

after the dna strands are separated, which of the following is the next step of DNA replication in the S phase of the cell cycle? Action of helicase formantion of RNa primer breaking go hydrogen bonds joining of nucleotides i think either B or D

science

Describe DNA replication in prokaryotes. Include the major steps for origins of replication, unwinding DNA, and synthesis of new strands. Include at least 1 simplified diagram.

science

Describe DNA replication in prokaryotes. Include the major steps for origins of replication, unwinding DNA, and synthesis of new strands. Include at least 1 simplified diagram.

7th grade science final

review Question -- 3 simple steps for DNA duplication I have found so many answers but cant get a concise one. 1. separation - of 2 dna strands unzips 2. duplicates 3. zips back up and then a simple sentence about each

biology

1.How many strands of mRNA are transcribed from the two "unzipped" strandsof DNA? 2.What are the three parts of an RNA nucleotide? 3.How does base pairing differ in RNA and DNA? 4.What is the function of mRNA? 5. What is a codon?

science

Assume that the hereditary information carried in genes and DNA is responsible many differences observed in humans and other living things. How could just four different bases in DNA strands be responsible for the almost endless variety found in nature?

Science

I did your corrections. I just wanted to know if all the sentences are correct from a scientific point of view. Thank you. 1) DNA contains instructions which decide which proteins a cell will make and consequently determines the whole chemistry of the cell. 2) DNA is found in ...

forensic

Which of the following is true about RFLP? (multiple answer) the repeat strands are very short it analyzes only mitochondrial DNA it involves amplifying DNA restriction enzymes are used to cut the DNA at the ends of the repeat sites length polymorphism is used to distinguish ...

science

A segment of double-stranded DNA contains 31% Adenine (A) bases. a. What are the percentages of the other three bases in the DNA segment? (Count bases on both strands.) C: T: G:

science

what is the number of strands in dna and rna?

English

I'd like you to check these sentences grammatically. I also would like you to see if the terminology I used is correct. Help me improve my paragraph, please. 1)DNA contains instructions which decide which proteins a cell will make and consequently determines the whole ...

bio

o What are some of the benefits of squeezing so much data into virtually every cell in the body? o Why did humans not evolve with one central repository of DNA rather than having it replicated throughout the body? o Assume that the hereditary information carried in genes and ...

biology

When does DNA synthesis occur? What is meant by leading and lagging strands?

BIOLOGY

If a PCR product is 659 bp, how many D1S80 repeats are present in that DNA molecule?

Science

Hi my textbook is not helping me at all, any links or ideas would be appreciated! What are some of the benefits of squeezing so much data into virtually every cell in the body? Why did we not evolve with one central repository of DNA rather than having it replicated throughout...

Science quick question

Is this right?? How do the structures of nucleotides attach to the old dna strands? Matching C with G and A with T?

Science help please!!!!!!!

Hi my textbook is not helping me at all, any links or ideas would be appreciated! What are some of the benefits of squeezing so much data into virtually every cell in the body? Why did we not evolve with one central repository of DNA rather than having it replicated throughout...

biology

I am absolutly 100% biology stupid... I don't understand it, it is like a foriegn language to me... this is my questions. What are some of the benefits of squeezing so much data into virtually every cell in the body? · Why did humans not evolve with one central repository of ...

math problem-

Bacteria grow in a nutrient solution at a rate proportional to the amount present. Initially, there are 250 strands of the bacteria in the solution which grows to 800 strands after seven hours. Find the time needed for the bacteria to grow to 1600 strands.

biology

In DNA, I know that hydrogen bond connects the nucleotides of each strand, but what type of bond holds the two strands together? is it covalent?

Biology - DNA

I'm trying to figure out why DNA forms a double helix and my biology book doesn't really specify why. I know about the anti Paralell strands with the 5 prime end and the 3 prime end and the complentary base pairs and it is hydrogen bonds that connect these base pairs such as A...

Biology

5. Dideoxynucleosides are employed in the course of the Sanger process of DNA sequencing. Dideocynucleosides are used because a) They stop the synthesis of DNA strands b) They are fluoresce c) They are radioactive d) They move quicly during gel electrophoresis e) They ...

biology

1. Which of the following statements does not describe a difference between the DNA of prokaryotes and the DNA of eukaryotes ? a.prokaryotic DNA is shorter and less complex than eurkaryotic DNA b. Prokaryotic DNA chains have two nucleotides, eukaroyotic DNA has four. c. ...

Physics

In the figure below, a spider is resting after starting to spin its web. The gravitational force on the spider is 0.167 N on the junction of the three strands of silk. The junction is supported by different tension forces in the two strands above it so that the resultant force...

Biology

In the final step of DNA extraction from E. Coli bacteria, we used ethanol so that the DNA would precipitate. Why is it that DNA precipitates in ethanol, and not in water? Both of them are polar solvents, and so is DNA. So why doesn't water make DNA precipitate?

genetics

Though this question sucks, which enzyme elongates the new DNA strand starting at an RNA primer? A.DNA polymerase I B.DNA polymerase III C.DNA polymerase II D.DNA ligase E.RNA polymerase

Biology

17. When errors in nucleotide sequencing occur, a. DNA polymerases replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...

Biology

17. When errors in nucleotide sequencing occur, a. DNA polymerases replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...

biology check answers please

The Hershey-Chase experiment proved that DNA was the hereditary material because. a) radioactive phosphorus in viral proteins was shown not to enter bacterial cells b) radioactive phosphorus in viral DNA was shown to enter bacterial cells **** (my choice) c) radioactive sulfur...

Biology Check my work please

The Hershey-Chase experiment proved that DNA was the hereditary material because. a) radioactive phosphorus in viral proteins was shown not to enter bacterial cells b) radioactive phosphorus in viral DNA was shown to enter bacterial cells **** (my choice) c) radioactive sulfur...

biology

When do strands of DNA form chromoshomes? What is a replicated chromosome? How does this differ from a chromosome pair? Is a cell containing replicated chromosomes haploid, diploid, or neither? Why? and Why is anaphase unique in terms of chromosome number?

bio

Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA is: A. Slightly ...

bio

Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA is: A. Slightly ...

Biology

Which of the following statements regarding DNA and RNA is true? DNA can melt while RNA cannot. DNA is resistant to alkaline hydrolysis while RNA is not. DNA contains phosphodiester bonds while RNA does not. DNA can form double helices while RNA cannot.

Science

The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies can be be made directly from the DNA I'm pretty sure the answer is D, ...

Physics

Stretching DNA. With its double-helix structure, DNA is coiled like a spring. A biophysicist grabs the ends of a DNA strand with optical tweezers and stretches it 26µm producing 1.2pN- tension in the strand. What's the DNA's spring constant?

DNA

Do the two DNA double helices following DNA replication have the same, or a different, composition?

Recombinant DNA

When you digest Vibrio DNA with Sal1, wh do you get mostly large DNA fragments?

genetics

DNA markers, or variant non-coding regions of DNA, are DNA polymorphisms that are useful for genetic mapping. True False

Biology/DNA

When doing a DNA extraction, what advantages does a TE buffer provide to DNA that water cannot?

Biology- DNA

What is needed to synthesize DNA? -a DNA strand -a primer and is that it?

genetics

Antiparallel means that: A.the two polynucleotide chains run in opposite directions. B.each DNA molecule consists of one old and one new strand. C.opposite strands are held together by base pairing. D.the helix twists to the right. E.there is complementary base-pairing

Science

what does DNA stand for? What is a gene? Where in the cell are chromosomes located? what two scientists established the structure of DNA? DNA is sometimes descrived as twisted ladder. What is this shape called? What forms the backbone of DNA? What forms the rungs of the ladder...

forensic

Select the proper order of examination "Fingerprints, trace evidence, DNA" "Disease diagnosis, DNA, fingerprints" "Ink analysis, content analysis, DNA" "Handwriting, ink analysis, DNA" None of the above my answer is the first one

Biology PleaSE help!

Hello, this is my biology assignment. I filled the answer's but I just need your help to correct me if I'm wrong Thank you. 1) The discovery of restriction endonucleases was crucial to the development of recombinant DNA technology because these enzymes. a) always cut DNA at ...

bio please help Ms sue

DNA is copied by an enzyme called DNA (A) __________, and the process of copying DNA is called (B) __________. The two new double-stranded DNA molecules have one strand from the original DNA molecule and one strand from the freshly assembled strand of nucleotides. This is ...

Science

How does DNA determine a trait such as eye color? A. DNA codes for proteins that determine eye color. B. DNA code for mRNA that detemines eye color. C. DNA interacts with proteins to control eye color. D. DNA contains pigments which make up eye color. Is the answer D? Thanks a...

Biology

Hello, this is my biology assignment. I filled the answer's but I just need your help to correct me if I'm wrong Thank you. 1) The discovery of restriction endonucleases was crucial to the development of recombinant DNA technology because these enzymes. a) always cut DNA at ...

Biology

1. How many base pairs are in a full turn or twist of a DNA molecule? 2. Name the complementary base pairs on DNA. A-T; G-C are the pairs, you name them. there are 10 1/2 base pairs for a full twist in DNA How does the nucleotide sequence in one chain of DNA compare with the ...

science

There are about 300,000,000 US citizens. If we wanted to assign each person a unique identifier, using DNA sequences, how long a DNA sequence would we need? (Here’s another way of phrasing the question: How many bases of DNA are required for there to be at least 300 million ...

Biology

For the DNA sequence given below, write the complementary DNA sequence that would compliment the double-strand DNA 3'--ATTGCTTACTTGCATGGTACCTCTAGCGTTTAGGC--5'

biology

DNA codes for mRNA, which is then translated into polypeptides,which are strands of amino acids. The DNA sequence below codes for the following amino acids: methionine-valine-glycine-alanine-alanine-serine TAC CAA CCA CGC CGC UCA What effect would the addition of the ...

physics

The physics of the DNA molecule. The two strands of the DNA molecule are held together by electrostatic forces. There are four bases which make up the DNA molecule, thymine (T), adenine (A), cytosine (C), and guanine (G). In two of the bases, thymine and adenine, an oxide ion ...

science-important!

I really need to make sure this is correct for tommorow please help! The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies ...

science-important!

I really need to make sure this is correct for tommorow please help! The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies ...

physics vectors

In the figure below, a spider is resting after starting to spin its web. The gravitational force on the spider is 0.158 N on the junction of the three strands of silk. The junction is supported by different tension forces in the two strands above it so that the resultant force...

Biology DNA

What are the components of DNA and how is the backbone of a single strand of DNA constructed? I put the components as nitrogenous base, deoxyribose molecule, and a phosphate group...I don't know the second part of the question :/

genetics

DNA is often purified by DNA electrophoresis, like in old-school DNA sequencing. In DNA electrophoresis, fragment separation is based on _____. (Best answer) A.fragment charge. B.fragment size. C.fragment sequence. D.fragment G-C content. E. fragment A-T content.

BIOLOGY

1.What is the function of DNA? 2.Name 3 parts of DNA molecule 3.Describe the shape of DNA molecule

BIOLOGY-DNA FINGERPRINTING

Okay soo i'm confused on DNA fingerprinting, i know what it is and everything but why do they call it DNA fingerprinting when a fingerprint is only a mark left by the person?

Science

RNA is thought to have proceeded proteins and DNA, why? A. more types of RNA than DNA B. single stranded RNA is less complex than DNA Not sure if either are correct?

Biology

If bird DNA is more similar to crocodile DNA than turtle DNA is to crocodile DNA, then... A)birds should be included amoung reptiles B)turtles and birds should be excluded from the reptiles C)the reptiles should be replaced by several new classes D)each of the above represents...

Physics

The two strands of the helix-shaped DNA molecule are held together by electrostatic forces as shown in the Figure 16-44 in the textbook. Assume that the net average charge (due to electron sharing) indicated on H and N atoms is 0.2e and on the indicated C and O atoms is 0.4e. ...

Science

How does a mutation in the DNA affect the way proteins are made? A. A mutation in the DNA results in misshapen tRNA molecules that do not fit inside the ribosomes. B. A mutation in the DNA results in a change in the mRNA and, ultimately, to a different protein structure. C. A ...

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12