Post a New Question

Chem/DNA

8,144 results

Biology
In the final step of DNA extraction from E. Coli bacteria, we used ethanol so that the DNA would precipitate. Why is it that DNA precipitates in ethanol, and not in water? Both of them are polar solvents, and so is DNA. So why doesn't water make DNA precipitate?

genetics
Though this question sucks, which enzyme elongates the new DNA strand starting at an RNA primer? A.DNA polymerase I B.DNA polymerase III C.DNA polymerase II D.DNA ligase E.RNA polymerase

science
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A or B. A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the correct DNA ...

Science-important!
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A or B. A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the correct DNA ...

science
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...

Biology
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...

Science
mismatch error to be repaired? Which is the best answer, I think it's A. Can someone who know's science tell me if I am right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...

bio
Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA is: A. Slightly ...

bio
Supercoiling of DNA can occur (choose all that apply): A. when double stranded DNA is overwound B. when double stranded DNA is underwound C. when double stranded DNA is heated above it's Tm D. when DNA is treated with nucleases and Generally, cellular DNA is: A. Slightly ...

Biology
Which of the following statements regarding DNA and RNA is true? DNA can melt while RNA cannot. DNA is resistant to alkaline hydrolysis while RNA is not. DNA contains phosphodiester bonds while RNA does not. DNA can form double helices while RNA cannot.

Science
The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies can be be made directly from the DNA I'm pretty sure the answer is D, ...

chem
Predict out of which of the following would a dialysis bag be permeable to? Potassium Ions= DNA= Sucrose= No? Starch =No? Sulfate Ion=yes Chloride Ion=yes Protein=No I'm not sure about potassium ions or DNA though.

Biology-Is my answer correct
Which of the following must occur for a mismatch error to be repaired? Which is the best answer, I think it's A, am I right? A)Damaged DNA must be identified by DNA repair proteins B)The sequence of nucelotides in the damaged DNA sequence must guide the synthesis of the ...

Physics
Stretching DNA. With its double-helix structure, DNA is coiled like a spring. A biophysicist grabs the ends of a DNA strand with optical tweezers and stretches it 26µm producing 1.2pN- tension in the strand. What's the DNA's spring constant?

DNA
Do the two DNA double helices following DNA replication have the same, or a different, composition?

Biology
In DNA fingerprinting, the DNA probe that is used is ______to the DNA sequence of the repeats in the sample? im guessing amplify????

Science
In DNA fingerprinting, the DNA probe that is used is ______to the DNA sequence of the repeats in the sample? im guessing amplify????

Recombinant DNA
When you digest Vibrio DNA with Sal1, wh do you get mostly large DNA fragments?

genetics
DNA markers, or variant non-coding regions of DNA, are DNA polymorphisms that are useful for genetic mapping. True False

Biology/DNA
When doing a DNA extraction, what advantages does a TE buffer provide to DNA that water cannot?

Biology- DNA
What is needed to synthesize DNA? -a DNA strand -a primer and is that it?

Science
what does DNA stand for? What is a gene? Where in the cell are chromosomes located? what two scientists established the structure of DNA? DNA is sometimes descrived as twisted ladder. What is this shape called? What forms the backbone of DNA? What forms the rungs of the ladder...

Bio/CHEM
11. You need to make a 1:8 ratio of DNA of two DNA types A and B (A:B). Your total aliquot should be 2ng/26 ìL. For each of the following sets, calculate how much of each extract you should use and how much TE-4: a. Extract A: 2.5 ng/20 ìL, Extract B: 252.3 pg/ìL b. Extract...

science- DNA
Of all possible DNA nucleotide sequences, what sequence of base pairs would dissociate most easily into single strands if the DNA duplex were heated gently?

genetics
What is a replication bubble? A.A complex of replication enzymes on the DNA template strand B.A DNA sequence that initiates replication C.A tangle of denatured DNA strands near the replication fork D.A locally denatured segment of DNA where replication originates E.A localized...

forensic
Select the proper order of examination "Fingerprints, trace evidence, DNA" "Disease diagnosis, DNA, fingerprints" "Ink analysis, content analysis, DNA" "Handwriting, ink analysis, DNA" None of the above my answer is the first one

bio please help Ms sue
DNA is copied by an enzyme called DNA (A) __________, and the process of copying DNA is called (B) __________. The two new double-stranded DNA molecules have one strand from the original DNA molecule and one strand from the freshly assembled strand of nucleotides. This is ...

Science
How does DNA determine a trait such as eye color? A. DNA codes for proteins that determine eye color. B. DNA code for mRNA that detemines eye color. C. DNA interacts with proteins to control eye color. D. DNA contains pigments which make up eye color. Is the answer D? Thanks a...

Biology
1. How many base pairs are in a full turn or twist of a DNA molecule? 2. Name the complementary base pairs on DNA. A-T; G-C are the pairs, you name them. there are 10 1/2 base pairs for a full twist in DNA How does the nucleotide sequence in one chain of DNA compare with the ...

science
There are about 300,000,000 US citizens. If we wanted to assign each person a unique identifier, using DNA sequences, how long a DNA sequence would we need? (Here’s another way of phrasing the question: How many bases of DNA are required for there to be at least 300 million ...

Biology
For the DNA sequence given below, write the complementary DNA sequence that would compliment the double-strand DNA 3'--ATTGCTTACTTGCATGGTACCTCTAGCGTTTAGGC--5'

psychology
Which one of the following statements describe the relationship between genes,chormosomes and DNA? A genes,the basic unit of heredity,are located on chromosomes,which consist of strands of DNA B genes are composed of chromosomes and Dna C chromosomes,tha basic unit of heredity...

psychology
Which one of the following statements describe the relationship between genes,chormosomes and DNA? A genes,the basic unit of heredity,are located on chromosomes,which consist of strands of DNA B genes are composed of chromosomes and Dna C chromosomes,tha basic unit of heredity...

Psychology
Which of the following statements describes the relationship between genes, chromosomes, and DNA? a. Genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA b. Genes are composed of and DNA c. Chromosomes, the basic unit of heredity, ...

science-important!
I really need to make sure this is correct for tommorow please help! The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies ...

science-important!
I really need to make sure this is correct for tommorow please help! The significance of specific base pairing in DNA is that A) it stabilizes the sugar molecule B) it provides a method for making exact copies of DNA C) it prevents errors in DNA replication D)protein copies ...

Genes
Which one of the following statements describes the relationship between genes, chromosomes and DNA a) genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA b) genes are composed of chromosome and DNA C) chromosomes the basic unit if ...

Biology DNA
What are the components of DNA and how is the backbone of a single strand of DNA constructed? I put the components as nitrogenous base, deoxyribose molecule, and a phosphate group...I don't know the second part of the question :/

psychology
Which one of the following statements describes the relationship between genes, chromosomes, and DNA? a. Genes, the basic unit of heredity, are located on chromosomes, which consist of strands of DNA.b. Genes are composed of chromosomes and DNA. c. Chromosomes, the basic unit ...

genetics
DNA is often purified by DNA electrophoresis, like in old-school DNA sequencing. In DNA electrophoresis, fragment separation is based on _____. (Best answer) A.fragment charge. B.fragment size. C.fragment sequence. D.fragment G-C content. E. fragment A-T content.

BIOLOGY
1.What is the function of DNA? 2.Name 3 parts of DNA molecule 3.Describe the shape of DNA molecule

Chem/DNA
Convert 10mg/mL into micrograms/microliters

Biology (check answer)
Transcription is similar to DNA replication in all of the following ways except: a) the DNA strands unzip b) the polymerase enzyme is involved c) complementary bases are paired up d) a new strand of mRNA is built from the existing DNA molecule is it d?

BIOLOGY-DNA FINGERPRINTING
Okay soo i'm confused on DNA fingerprinting, i know what it is and everything but why do they call it DNA fingerprinting when a fingerprint is only a mark left by the person?

Science
RNA is thought to have proceeded proteins and DNA, why? A. more types of RNA than DNA B. single stranded RNA is less complex than DNA Not sure if either are correct?

Biology
If bird DNA is more similar to crocodile DNA than turtle DNA is to crocodile DNA, then... A)birds should be included amoung reptiles B)turtles and birds should be excluded from the reptiles C)the reptiles should be replaced by several new classes D)each of the above represents...

Science
How does a mutation in the DNA affect the way proteins are made? A. A mutation in the DNA results in misshapen tRNA molecules that do not fit inside the ribosomes. B. A mutation in the DNA results in a change in the mRNA and, ultimately, to a different protein structure. C. A ...

Science
How does a mutation in the DNA affect the way proteins are made? A. A mutation in the DNA results in misshapen tRNA molecules that do not fit inside the ribosomes. B. A mutation in the DNA results in a change in the mRNA and, ultimately, to a different protein structure. C. A ...

Bio...DNA
Can anyone explain the relationship between the structure of DNA , protein structure and phenotype of an organism? Also, what is the role of DNA in protein synthesis? I will give you a little hint. The DNA makes the RNA. The RNA makes the proteins by amino acid building blocks...

Biology
1. Why must DNA be able to make copies of itself? 2. Define DNA replication? 3. What is the first step that must occur in DNA replication?

biology
i have some notes but before christmas break was here i had surgery so i didn't get to finish my notes in class and i don't understand much of my work so heres part of my notes: DNA and RNA Differences: #of strands for DNA? RNA? sugar DNA? RNA? Base that binds with Adenine DNA...

BIOLOGY
As cells get older, DNA gets damaged and lowers in DNA repair process what is the initial effect? Since this is not my area of expertise, I searched Google under the key words "DNA aging" to get these possible sources: http://www.chem-tox.com/DNA/aging.htm http://www.benbest....

biology
How is recombinant DNA technology used today? I have to use bacterial chromosomal or genomic DNA,plasmid,restriction enzyme, vector, sticky end, transformation, DNA ligase, gene cloning,restriction fragment, and restriction site in the answer.

Biology
The polymerase chain reaction (PCR) is useful for: A) making many copies of a small amount of DNA B) creating recombinant plasmids C) analyzing a person’s fingerprints D) cutting DNA into many small pieces E) allowing restriction enzymes to cut DNA at palindromes I can't ...

Chemistry-Just checking my answer
For each template DNA, I prepared a second PCR reaction that includes "GMO" primers. Assume that all three foods had usable plant DNA. Which template DNA (non-GMO,GMO,test food) would you expect to show successful amplification of the "GMO" target sequence? I said all three ...

Science
Can someone tell me if I answered my question correctly? During the cell cycle when does DNA replication take place? During interphase and the DNA synthesis separates the eukaryotic cells into four phases. Gap 1 phase is the intervals between mitosis and initiation of DNA ...

Biology
17. When errors in nucleotide sequencing occur, a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...

Biology
17. When errors in nucleotide sequencing occur, a. DNA polymerase replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines replace pyrimidines in the DNA molecule d. DNA ...

Genetics
A viral DNA is analyzed and found to have the following base composition, in mole percent: A = 32, G = 16, T = 40, C = 12. What can you immediately conclude about this DNA? a stretch of double stranded DNA contains 1000 base pairs and its base composition is 58 % (G + C). How ...

biochem
dna template of auc? dna template of met? would that be ATC or TAG? Met's rna temp would be AUG. so its dna is TAC? or ATG? im confused.

Biology
1.) Prophage occurs when a.) It bonds with carbohydrates to create a virus b.) Bacteriophage DNA embeds itself in host DNA c.) It detaches from carbohydrates to create a virus. d.) Bacteriophage DNA detatches itself from host DNA. D.

how do protons move during electrophoresis
During electrophoresis, protons move in the same direction as DNA. do not move at all. move in the opposite direction as DNA. move randomly. I am thinking they move in the same direction as DNA or am I wrong? DNA travels in accordance with its principal charge, negative, the ...

dna strands/sequences
The restriction enzyme EcoR1 recognizes the DNA sequence GAATTC. Which DNA strands will be cut by EcoR1? I. TTCAGGAATTCGGAAACC AAGTCCTTAAGCCTTTGG II. TGAATCGAACCTG ACTTAGCTTGGAC III. TTAAGCGGCCGAATTCAGTCCA AATTCGCCCGCTTAAGTCAGGT IV. CAGTAGGATTTCTGTGTC GTCATCCTAAAGACACAG I and ...

genetics
The definition of transformation is: A.the shift of genetic information from DNA to protein. B.the recombination of DNA strands during meiosis C.the uptake of genetic information by a cell from the environment. D.the combining of DNA during fertilization. E.the changes caused ...

Biology DNA
can somebody please explain the relationship between the structure of DNA, protein structure and the phenotype of an organism and the relationship between DNA chromatin and chromosome

biology
A common first step in the making of a DNA library is to obtain DNA from many of your chosen organisms and cut this source DNA with a restriction enzyme. It is likely that some genes will contain sites for the chosen restriction enzyme, and in this case, your DNA library will ...

Biology
14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of the above D? 16. During DNA replication, all of ...

Biochemisty
The DNA alpha-helix structure has 566900 complete turns. The average molar mass of one base pair of nucleotides in DNA is approximately 469 g/mol. If the spacing between successive base pairs is about 0.69 nm, and a complete turn in the helical structure of DNA occurs every 6....

chemistry
The total mass of DNA in the body is 50.0 g. If the number of nucleotides in ONE STRAND of DNA is approximately 3.0 x 106, and the average length of a single nucleotide is 0.34 nm, what is the length (in km) of one strand of DNA when it is stretched out to its maximum length (...

Biology
Kay so these are the strands of DNA 5' C C A G T A G T T 3' 3' G G T C A T C A A 5' Let's say the DNA molecule above were the parent strand of DNA. when the strands are split for replication, which strand would be the template for the leading strand? And can you also please ...

science
How often would a restriction enzyme such as Not I, which has 8 nucleotides in its recognition sites 5’-GCGGCCGC-3’, cleave DNA on average? Would it cleave a species DNA more or less often if the DNA from that species were 70% A-T rich?

science
how does the structure of DNA help account for the way in wich DNA copies itself

Biology
How are the hydrogen bonds broken during DNA replication? Is it done by the DNA polymerases?

Biology
What would happen during DNA replication if DNA polymerase was not functional

Science
How do you think a scientist might figure out a person’s identity from bones? My answer I think that depending on the shape and size of the bones are different for every person like you DNA. This is how they know who you are. it is also possible that your bones carry DNA or ...

another bio ?
what direction along a DNA strand does DNA polymerase add base pairs

Biology
what properties/features of DNA allow DNA to have uniformity and be a universal molecule?

sci 230
Missing DNA? Do we have any cells with no DNA? What would they be like? What could they be used for?

Biology- DNA
why dna replication necessary to life? i think it because it carry genetic information?

science
(a) Investigators often remove blood from a crime scene in order to extract DNA for forensics. Although blood cells do contain nucleic acids, why would blood yield relatively less DNA than semen containing sperm cells? (b)What are some other uses for DNA extracted from a human...

DNA &RNA
State two differences between DNA and RNA. we did not study this at all, so far I see that DNA has several million nucleotides, the smaller RNA only has several thousand of them. the second thing I noticed is that they both have a base,a five carbon sugar and a phosphate group...

BIOLOGY (DNA)
Why does DNA have the consistancy of thick syrup or mucus? because of all of the different substances

Science
What is the purpose on DNA This is a very interesting article on the purposes of DNA. (Broken Link Removed)

science-biology
name two processes for which DNA is responsible for what are the three components to a DNA nucleotide

science (Genetics and Evolution)
What contains DNA? Where is DNA found? What is the difference between phenotype and genotype?

10th Grade Science
-What contains DNA? -Where is DNA found?

Science-DNA
Why DNA cannot grow from 3’ to 5’ direction — why this is important for proofreading?

Chemistry-Just checking my answer
for template DNA (non-GMO,GMO,and test food) we set up a PCR reaction that included "plant' primers. Assume that all three foods had usable plant DNA. Which template DNA (non-GMO,GMO, test food) would you expect to show successful amplification of the "plant" target sequence? ...

living environment
What is the name for the DNA molecule that would result if the two pieces of DNA were joined together?

Biology
I am supposed to make different ligations. These are the stocks I am given: Cut pET41a(+) DNA: 25 ng/ul egfp insert DNA: 7 ng/ul Uncut pET-41a(+)/EGFP recombinant plasmid DNA: 25 ng/ul This is the ligation I am supposed to make: Ligation #1: 1:1 molar ratio pET-41a(+) vector: ...

AP BIO
2. Suppose the DNA molecule were composed of six monomers. In addition to the monomers A, T, C and G, two other monomers, O and P, were present. Furthermore, O and P were known to pair only with each other. Which of following statements regarding this kind of DNA molecule ...

biology- DNA
Explain the function and structure of DNA.

biology what is DNA
why is DNA replication necessary to life?

Biology
Which of the following is true about DNA? It is a single-stranded molecules Only one of the original DNA strands acts as a template during replication. Both of the original DNA strands act as templates during replication. Its replication takes place in the cytosol.

BIOLOGY
WHEN A DNA MOLECULE IS COPIED TO MAKE ANOTHER DNA MOLECULE, WHICH STATEMENT BEST DESCRIBES THE RESULTING STRANDS? A. ONE DOUBLE STRANDED DNA MOLECULE IS THE ORIGINAL AND THE OTHER A NEW COPY B. BOTH RESULTING STRANDS ARE ENTIRELY MADE OF NEW DNA BASED ON THE INFORMATION IN AN ...

AP Biology- Molecular Genetics
The correct sequence between genes and their phenotypic expression is a) RNA-DNA-protein-trait b) DNA-RNA-protein-trait c) Protein-DNA-RNA-trait d) trait-DNA-RNA-protein I think it is either b or d but do not know if the trait is at the beginnig or end... Once translated, the ...

Science
After replicated a DNA molecule with two strands three times, how many molecules of DNA are formed? Is eight the correct answer?

Biology 12-DNA
suppose you knew the makeup of specific proteind in a cell. how would you determine the particular DNA code that coded for them?

Genetics
The genome of Elradicus hypotheticus consists of 3 x 105 bp of B-DNA. a. How many turns are present in the double-helix? b. What is the length of the DNA in μm?

chemistry
The human body is said to contain approximately 50.0 grams of DNA in the entire body. If the number of nucleotides in ONE STRAND of DNA is approximately 3.0 x 106, and the average molar mass of a nucleotide is 327 g/mol, what is the average molar mass of an entire DNA double ...

  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. Next>>

Post a New Question