A person applying for a sales position is offered an alternative salery plan. Plan A- A base salery of $600 per month plus a commission of 4% of the gross value for the month Plan B- A base salery of

74,757 results, page 73

Finance

You hold a diversified portfolio consisting of a $10,000 investment in each of 15 different common stocks (i.e., your total investment is $150,000). The portfolio beta is equal to 1.1 . You have decided to sell one of your stocks which has a beta equal to 0.9 for $10,000. You ...

Finance

You are the supervisor for a large technology-based corporation. One of your subordinate managers, Carly, is heading up a project for a new system that is scheduled to market on the 1st of the year. It is August and things are not progressing at the pace you had hoped. When ...

pre - CALCULUS

A gas company has the following rate schedule for natural gas usage in single-family residences: Monthly service charge Per therm service charge 1st 25 therms Over 25 therms $8.80 $0.6686/therm $0.85870/therm What is the charge for using 25 therms in one month? Show your work...

Math

Li making beaded necklaces.for each necklace,she uses 27 spacer beads, plus 5 glass beads per inch of necklace length. write an equation to find how many Li needs for each necklace.

Finance

Madison Metals recently reported $9,000 of sales, $6,000 of operating costs other than depreciation, and $1,500 of depreciation. The company had no amortization charges and no non-operating income. It had issued $4,000 of bonds that carry a 7% interest rate, and its federal-...

Business

how are data and information used within the human services organizations to support organizational planning? How can you plan for anything without having any data/information on the topic? The same is true of any organization. You need to know what your goals/purposes are and...

Grade 6: money and measures

An empty rectangular tank with a base are of 2400 cm2 is filled with water from two taps.one tap can fill the tank with 12 liters of waTer per minute while the other tap can do it at 3 liters per minute. a. what will be the depth of water in the tank after both taps are turned...

math

Alice Correa bought three yards of cloth to make a dress. The cloth was on sale for $1.93 per yard. How much did Alice pay for the cloth if the sales tax was 5 percent?

math

Dawn Lingua bought three yards of cloth to make some curtains. The cloth was on sale for $2.25 per yard. How much did Dawn pay for the cloth if the sales tax was 5%?

MATH

Dawn Lingua bought three yards of cloth to make some curtains. The cloth was on sale for $2.25 per yard. How much did Dawn pay for the cloth if the sales tax was 5%

math

Dawn Lingua bought three yards of cloth to make some curtains. The cloth was on sale for $2.25 per yard. How much did Dawn pay for the cloth if the sales tax was 5%?

math

Alice Correa bought three yards of cloth to make a dress. The cloth was on sale for $1.93 per yard. How much did Alice pay for the cloth if the sales tax was 5 percent?

Managerial Economics

The MorTex Company assembles garments entirely by hand even though a textile machine exists which can assemble garments faster than a human can. Workers cost $50 per day, and each additional laborer can produce 200 more units per day (the same for each additional worker). ...

math

Gasoline is about $4 per gal. You use about gallons each day driving to and from work. How much should you budget for gas over the next month (about 20 workdays)?

Algebra

Geppetto is a puppet maker. He starts the month with 3 puppets ready to sell, and makes 9 puppets per day. Write an equation to model this situation (use d for days and p for puppets).

childcare

2. Rachel's parents enrolled her in your after-school program in September. In October, Rachel and another girl named Callye started planning a holiday play for December. They worked on the plan everyday. Soon they became inseparable. In December, parents were invited to watch...

Algebra

The CarryItAll​ mini-van, a popular vehicle among soccer​ moms, obeys the demand equation ppequals=negative StartFraction 1 Over 40 EndFraction x plus 19 comma 000−140x+19,000. The cost of producing xx vans is given by the function Upper C left parenthesis x ...

Math

A car dealer will sell you a used car for $6,664 with $664 down and payments of $174.50 per month for 48 months, what is the simple interest rate?

Algebra

A car dealer will sell you a used car for 5,107 with 107 down and payments of $152.92 per month for 48 months. What is the simple interest rate?

Math

Alma subscribes to a website for processing pictures. The subscription is $5.95 per month and 4-by-6 inch prints are$0.19 each. How many prints does Alma purchase if the charge fir January is $15.83?

Math

An invoice states that interest will be charged on overdue accounts at the rate of 1% per month. What will the interest charges be on a $3760 billing that is three months overdue?

Career

How Much does a Ferrari rent cost per month? I need to know this for a career project, which car i want and i want a Ferrari, i tried searching it but I can't find it!:( Plz help asap:)

Math

Morgan subscribes to a website for processing her digital pictured. The subscription is $5.95 per month and 4 by 6 inch prints are $0.19 each. How many prints did Morgan purchase if the charge for January was $15.83?

Statistics

A study is conducted regarding shatterproof glass used in automobiles. Twenty-six glass panes are coated with an anti-shattering film. Then a 5-pound metal ball is fired at 70mph at each pane. Five of the panes shatter. We wish to determine whether, in the population of all ...

Finance

Company reported $9,000 of sales, $6,000 of operation costs other than depreciation, and $1,500 of depreciation. The company had no amortization charges and no non-operation income. It had issued $4,000 of bonds that carry a 7% interest rate, and its federal-plus-state income ...

english

how manymen were on the federal trade commission?

accounting

what is the function of the securites and exchange commission

algebra

How can I solve a graduated commission scale.

math

what is the total commission of 14% on a $3000 sale??

Physics

What is the weight of an object that has a base which is 3 square cm and which exerts a pressure of 21 kg per square meter?

Manangerial Econ

You manage a U.S. based company that makes #2 pencils that sell in a highly competitive market (your pencils are considered a standardized commodity by your customers). Your marketing data predicts that in the upcoming year overall industry production will fall by at least 5% ...

math solve the problem using the four step plan

At the end of their 3-day vacation, the Palmers traveled a total of 530 miles. On the third day,they drove 75 miles. On the second day,they drove 330 miles. How many miles did they drive the first day? I can only solve this by adding the second, and third days, and subtracting...

writing skills

6. Which of the following skills is most important in learning how to write? [A. Knowing how to plan before you write] B. Knowing proper grammar before you write C. Knowing proper punctuation before you write D. Knowing how to use the Readers' Guide before you write

math

an altitude of triangle is 5/3rd of the length of its corresponding base if their altitude be increased by 4cm and the base is decreased by 2cm, the area of the triangles remain the same. find the base and altitude of triangle ?????

Chemistry

The following questions relate to acid base reactions. a) What type of reaction is said to occur when an acid reacts with a base.? ……………………………… b) What are the general products of such a reaction? i.e. An acid + a base produces...

Algebra II

A rental cas cost a minimun charge plus a fixed chrger per mile drive. One customer drove 280 miles and paid (0$. Write an equation relating the total cost, C (in dollars), to the miled driven, X.

Physics

Early skeptics of the idea of a rotating Earth said that the fast spin of Earth would throw people at the equator into space. The radius of Earth is about 6400 km. Show why this objection is wrong by determining the following information. a.) Calculate the speed of a 103-kg ...

physics

Early skeptics of the idea of a rotating Earth said that the fast spin of Earth would throw people at the equator into space. The radius of Earth is about 6400 km. Show why this objection is wrong by determining the following information. a.) Calculate the speed of a 103-kg ...

physics

a wheel having diameter 2m starts from rest and accelerates uniformly to an angular velocity of 75 revoulutions per minute in 5s. calculate its angular acceleration? Q;- one of the rectangular components of velocity of 80km/hr find other component? Q:-the diameter of sphere is...

BIO 12

BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A and T, Position #2 ...

calculus

A box is constructed out of two different types of metal. The metal for the top and bottom, which are both square, costs $4 per square foot and the metal for the sides costs $4 per square foot. Find the dimensions that minimize cost if the box has a volume of 50 cubic feet. ...

Calculus

A box is constructed out of two different types of metal. The metal for the top and bottom, which are both square, costs $2 per square foot and the metal for the sides costs $7 per square foot. Find the dimensions that minimize cost if the box has a volume of 30 cubic feet. ...

graphing

How do you graph y= -log (base 5)(-x)? The written question is: Sketch above equation by first describing the transformations performed on the equation y= log (base 5)(x) And what is the inverse function? x=log (base 5)(y)?

math

isosceles trapezoid with a perimeter of 52 yards the measure of one base is 10 yards greater than the other base the measure of each leg is 3 yards less than twice the length of the shorter base

Chemistry(Please check)

List the conjugate base for the following acids: 1) Acid = CH3CH2CH2NH3^+ Conjugate base = CH3CH2CH2NH2^- 2) Acid = CH3CH2CH2OH2^+ Conjugate base = CH3CH2CH2OH^- Are my answers correct? Thank you!

thermodynamics

A heat engine, X, operates between a reservoir at 1000˚C and a body at 600˚C. Heat transfer to the heat engine is 1000 kJ and work output is 220 kJ. Another Engine, Y, operates between, the body at 600˚C and the atmosphere at 27˚C. Heat rejected to the atmosphere is 400 kJ...

accounting

Situation Parent, Inc. is contemplating a tender offer to acquire 80 percent of Subsidiary Corporation's common stock. Subsidiary's shares are currently quoted on the New York Stock Exchange at $85 per share. In order to have a reasonable chance of the tender offer attracting ...

Intermediate Financial accounting III

The common stock of Warner Inc. is currently selling at $114 per share. The directors wish to reduce the share price and increase share volume prior to a new issue. The per share par value is $8; book value is $77 per share. 5.24 million shares are issued and outstanding. ...

marketing

Define one specific problem it could address through marketing research. What type of research design do you recommend for addressing that problem, and why? What is the most appropriate way to collect the data? Justify your choice. How will you ensure high validity, ...

stats

You are a travel agent and wish to estimate, with 95% confidence, the proportion of vacationers who plan to travel outside the United States in the next 12 months. Your estimate must be accurate within 3% of the true proportion Find the minimum sample size needed, using a ...

Physics

In the figure, a thin uniform rod of mass m = 3.05 kg and length L = 1.11 m rotates freely about a horizontal axis A that is perpendicular to the rod and passes through a point at a distance d = 0.201 m from the end of the rod. The kinetic energy of the rod as it passes ...

Math

It took Steve and his construction crew 8 months to build a house. Alfter expenses, he was left with $24,872.67 himself. on average, how much did Steve make per month? Round to the nearest dollar.

ALGEBRA

Suppose you see a car with an advertised price of $30,250 at $605.15 per month for 5 years. What is the amount of interest paid? I need help with this problem.Please give me the steps to figure this problem out.

finite math

if you buy a computer direct from the manuf, $3080 and agreed to repay it in equally 36 months installed at 2.06% interest per month on unpaid balance. How much are the monthly payment? How much will be paid?

math

Mrs. Hart, at age 65, can expect to live for 25 years. If she can invest at 5% per annum compounded monthly, how much does she need now to guarantee herself $900 every month for the next 25 years?

Maths

Rajesh gets Rs 240 per month. He spends one-third of it on ice creams ,one-half on comic books and the remaining on wafers . Find the ratio of the money spent on each item

Math

Mrs. Hart, at age 65, can expect to live for 25 years. If she can invest at 8% per annum compounded monthly, how much does she need now to guarantee herself $300 every month for the next 25 years?

Algebra Word Problem

COULD SOMEONE PLEASE HELP ME WITH THIS !!!!!!!!!! The base of a triangle is 3cm greater than the height. The area is 44cm^2. Find the height and length of the base. The height of the triangle is_______ cm The base of the traingle is_______cm

Physics

A decibel meter reads 130 dB at a certain position from a jet plane when one engine is turned on. a) What is the sound intensity at that position? b) What would be the sound level at the same position if two engines are turned on each having the same intensity as the first? ...

Information Technology (Pascal algorithm)

Ask the user to enter the discount percentage(rate) offered in a sale Accept the discount percentage from the user Ask the user to enter the price for three different sales item Accept the prices of the three sale items Compute the total price of the three items Compute the ...

Corporate tax

11. Molly, Inc. a domestic corporation, owns 15% of PJ. Inc. and 12% of Emma, Inc., both foreign corporations. Molly is paid gross dividends of $35,000 and $18,000 from PJ and Emma, respectively. PJ withheld and paid more than $10,500 in foreign taxes on the $35,000 dividend. ...

Math

The rates for Internet use offered by three companies are shown below. Company A: $6.00 every 90 minutes of use Company B: $2.75 every 45 minutes of use Company C: $3.00 for every 60 minutes of use Which company offers the lowest rate per minute?

Calculus

A man standing 9 feet from the base of a lamppost casts a shadow 6 feet long. If the man is 6 feet tall and walks away from the lamppost at a speed of 30 feet per minute, at what rate, in feet per minute, will his shadow lengthen?

Finance

Juan and Rachel Burpo plan to buy a time-share in six years of $16,860. In order to have adequate funds to do so, the Burpo want to make a deposit to their money market fund today. Assume that they will be able to earn an investment rate of 5.75%, compounded annually. How much...

Math

Hey, I posted this question before, but I really need some help. Thanks... -- A delivery business plans to serve three towns on a stretch of highway. For every trip they make to town A, which we'll place at position x=0, they expect to make two trips to town B (at position x=1...

public administration

Assume that after all the rhetoric and great debates on health care reform that Congress decided the rate regulation that has been used for a century to control the prices and services of common carriers in transportation is an appropriate model. It therefore established the "...

Information technology

Write a structured algorithm that prompts the user to input the number of days in a month. Calculate and print the number of hours in the month appropriately labelled.

Programming 1

1.Do the planning and write an algorithm to solve the following problem. Prepare test data for the example to test all possibilities and draw a trace table. Sam works at a coffee company where all the employees receive a bonus of R700, except the employees in the coffee ...

Unisa

1.Do the planning and write an algorithm to solve the following problem. Prepare test data for the example to test all possibilities and draw a trace table. Sam works at a coffee company where all the employees receive a bonus of R700, except the employees in the coffee ...

Pre AP Physical Science

If a person's average speed for a 10.00 kilometer race is 5.644 meters per second, what was her winning time?

Math

If a person is charged 1.5 cents per mile,how much will he have to pay after he drives one thousand miles?

Physics

A spring with k=40.0 N/m is at the base of a frictionless 30.0 degree inclined plane. A 0.50-kg object is pressed against the spring, compressing it 0.20m from its equilibrium position. The object is then released. If the object is not attatched to the spring, how far up the ...

Physics

A spring with k=40.0 N/m is at the base of a frictionless 30.0 degree inclined plane. A 0.50-kg object is pressed against the spring, compressing it 0.20m from its equilibrium position. The object is then released. If the object is not attatched to the spring, how far up the ...

Algebra

What kind of formula do i use to find out the cheapest rate to use for the car rental? Mr. Smith wants to rent a Suv to go from home to a conference in Seattle, he expects to do 350 miles in total during this journey There are 3 rental companies: Hertzy Rental-Fixed rate of $...

Geometry

A child is using sidewalk chalk to draw a triangular-shaped area for a game. If the height of the area is twice the base, and the base is 6 feet, wat is the area of the game? I know b=6 & h=2 x base (2x6)..I need help please

math

given that c is the logarithm of x in base a, and d is the logarithm of x in base b, find the general statement that expresses the log of x ib base ab, in terms of c and d. I couldn't include subscripts, but here are what the logs should look like: loga_x=c ; logb_x=d......

Calculus

A baseball diamond is a square with side 90 ft. a batter hits the ball and runs toward first base with a speed of 24 ft/s. (a) At what rate is his distance from second base decreasing when he is halfway to first base? Is the answer 0.0932ft/s? I don't see that it is logical ...

Reading

18. Of the following points of view, which one gives a reader the most insight into the minds of the characters? A. First-person major participant B. First-person reporting C. Third-person dramatic D. Third-person unrestricted omniscient 19. Of what nationality are the people ...

World History

What events led up to the cold war? I have this so far please tell me what i need to add, I need real events... The u.s and britan tried to counter russia's manipulation of eastern Europe. In 1945 the U.s developed the atomic bomb. in 1947, the u.s proclaimed the marshall plan...

Math

Write equations that equal the number 44 using exactly four 4's 4sqred plus 4sqred plus 4qred minus 4 (donno if it counts) Hi Tom , We can only use the symbols of multiplication, division, subtraction and addition. Please try again Thanks 4-4+44 = 44

Math

This needs to be worked backwards. Four classmates are comparing the number of pages that they have read in a novel assigned for their language-arts class. Ken has read twice as many pages as Jenny. Alicia has read 18 pages more than Jenny and 11 pages more than Mark. Mark has...

Math

Find the value of the sine of the smallest angle in standard position with the point (-12, 5) on its terminal side. Give as four decimals. a. 0.3846 b. -0.4167 c. 0.4167 d. 2.6000

Algebra

In January sales were 2.08 million. Write the sales for January in standard notation and scientific notation. please help

physics

Two fan carts with different fan speeds and different accelerations are started from rest some distance from one another. Cart A begins at position 0 with a velocity of zero and an acceleration of aA to the right. Cart B begins at position xB with a velocity of zero and an ...

Physics

A 24.00 kg block at rest on a horizontal frictionless air track is connected to the wall via a spring. The equilibrium position of the mass is defined to be at x=0. Somebody pushes the mass to the position x=0.3500 m, then lets it go. The mass undergoes simple harmonic motion ...

biology

Which candy required more base per gram of candy sweet tarts or smarties

critical thinking

property owned by black residents in Washington D.C 1830-1860 property value(dollars)-no. of owners 1830 1840 1850 1860 1-200 26 30 21 8 200-400 20 35 58 51 400-600 13 26 32 69 600-800 7 16 20 61 800-1000 2 5 11 48 1000-1500 2 8 19 69 1500-2000 1 1 1 21 2000-2500 1 2 4 20 2500...

economic

ASSIGNMENT 5: DUE 4.00PM, 4/09/08 1. A competitive firm uses coal to generate electricity. Its supply curve is Q = 300P - 1000, where Q is quantity produced (units of electricity per year), and P is market price of electricity per unit. The production of each unit of ...

Inflation Exam

Inflation Exam 1) You are developing a data base for Army tracked combat vehicles and you are normalizing the data base to base year 2014 dollars. What number would you enter into the data base for a vehicle budgeted at $4,725,000 in the FY18 appropriation? (Use the inflation ...

physics

You meet a person with prescription glasses of +1.74 dpt. What is the near point of this person? Express the result as a positive number! Hint: the near point of a healthy person is 25 cm. An object placed at this distance will form an image at the near point of the person. 1....

gen 105

applying personality and learning styles

I.E.D

How do you envision applying your sketching skills in other classes?

pltw

How do you envision applying your sketching skills in college?

Health (Ms. Sue)

Differentiate between environmentally spread diseases and diseases that are spread from person to person. A: Environmentally spread diseases are spread by physical contact of objects in the environment, such as the telephone, doorknobs, and soil, in which are covered with ...

Consumer Math

1. Dawn Lingua bought three yards of cloth to make some curtains. The cloth was on sale for $2.25 per yard. How much did Dawn pay for the cloth if the sales tax was 5%? A. $8.07 (B.) $2.36 C. $7.25 D. $7.09

statistics

The average amount of time people spend on facebook each day is 71 minutes, with a standard deviation of 4.7 minutes. Are you more likely to select a random person that spends less than 68 minutes per day, or a group of 35 people that spend on average less than 65 minutes per ...

Auditing

I need help with this. I was presented with this question: Analytical procedures show that inventory turnover decreased from 31–34 days to 27 days, and gross margins declined to the lowest level in five years. What might this indicate about the risk of misstatement with ...

English

“When Gradnmama died at 83 our whole household held its breath. She had promised us a sign of her leaving, final proof that her present life had ended well.” Based on the introductory line from “The Jade Peony” by Wayson Choy, what is the point of view of this story? A...

English

“When Gradnmama died at 83 our whole household held its breath. She had promised us a sign of her leaving, final proof that her present life had ended well.” Based on the introductory line from “The Jade Peony” by Wayson Choy, what is the point of view of this story? A...

Finite Math

A certain virus infects one in every 500 people. A test used to detect the virus in a person is positive 90% of the time if the person has the virus and 10% of the time if the person does not have the virus. Find the probability that a person does not have the virus given that...

Pages

  1. 1
  2. 2
  3. 3
  4. 4
  5. 5
  6. 6
  7. 7
  8. 8
  9. 9
  10. 10
  11. 11
  12. 12
  13. 13
  14. 14
  15. 15
  16. 16
  17. 17
  18. 18
  19. 19
  20. 20
  21. 21
  22. 22
  23. 23
  24. 24
  25. 25
  26. 26
  27. 27
  28. 28
  29. 29
  30. 30
  31. 31
  32. 32
  33. 33
  34. 34
  35. 35
  36. 36
  37. 37
  38. 38
  39. 39
  40. 40
  41. 41
  42. 42
  43. 43
  44. 44
  45. 45
  46. 46
  47. 47
  48. 48
  49. 49
  50. 50
  51. 51
  52. 52
  53. 53
  54. 54
  55. 55
  56. 56
  57. 57
  58. 58
  59. 59
  60. 60
  61. 61
  62. 62
  63. 63
  64. 64
  65. 65
  66. 66
  67. 67
  68. 68
  69. 69
  70. 70
  71. 71
  72. 72
  73. 73
  74. 74
  75. 75
  76. 76
  77. 77
  78. 78
  79. 79
  80. 80
  81. 81
  82. 82
  83. 83
  84. 84
  85. 85
  86. 86
  87. 87
  88. 88
  89. 89
  90. 90
  91. 91
  92. 92
  93. 93
  94. 94
  95. 95
  96. 96
  97. 97
  98. 98
  99. 99
  100. 100