Science Fossils

When might preserved remains of an entire organism form?

A. When sediment buries the hard part of an organism. (this one)

B. When an event such as quick burial or freezing preserves an entire organism.

C. When minerals replace parts of an organism.

D. When a thin layer of carbon is left on a rock.

  1. 👍 0
  2. 👎 0
  3. 👁 638
  1. I disagree.

  2. Right.

    Think of mummies and the Ice Man.

  3. So it would be B

    1. 👍 1
    2. 👎 0
    posted by Sami
  4. I say B because it's what happened with the dinosaurs

    1. 👍 0
    2. 👎 1
  5. 1. B
    2. B
    3. A
    4. True

    1. 👍 6
    2. 👎 0
    posted by Hal
  6. hal is right 100%

    1. 👍 0
    2. 👎 0
    posted by kilo
  7. 1) B
    2) B
    3) A
    4) True
    Hal is right I got 100% thx Hal

    1. 👍 0
    2. 👎 0
    posted by Babe

Respond to this Question

First Name

Your Response

Similar Questions

  1. Science

    1.) when might preserved remains of an entire organism form? A.) when sediment buries the hard part of an organism B.) when an event such as a quick burial or freezing preserves an entire organism ******* C.) when minerals replace

    asked by Zach on February 29, 2016
  2. Earth Sci

    A cobble-sized sediment is naturally broken off the steep sides of a valley in a mountainous region. The sediment falls onto a glacier that occupies much of the valley. Over several years, the sediment “falls through” the

    asked by Ivy on January 7, 2009
  3. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC

    asked by Maria on October 28, 2016
  4. Calculus Help Please!!! URGENT!!!!

    Carbon-14 has a half-life of 5700 years. In a living organism, the ratio of radioactive carbon-14 to ordinary carbon remains fairly constant during the lifetime of the organism. After the organism’s death no new carbon is

    asked by Taylor on April 7, 2014
  5. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The

    asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! on May 7, 2014
  6. Science

    Why is it rare for the soft parts of an organism to become a fossil? A. the soft parts take a long time to decay. B. the soft parts can be eaten by other animals.* C. the soft parts cannot be buried in sediment. D. the soft parts

    asked by Anonymous on October 30, 2013
  7. science PLEASE CHECK MY ANSWERS

    1. why is it rare for the soft parts of an organism to become a fossil a. the soft parts take a long time to decay. b. the soft parts can be eaten by other animas. c. The soft parts cannot be buried in sediment.>>>my answer d. the

    asked by FluttershyK22 on April 11, 2016
  8. earth

    Which of the following illustrates the formation of a delta? A)Sediment is deposited where a river flows into an ocean or lake. B)Sediment is deposited where an ocean flows into a river. C)Sediment is deposited where a stream

    asked by Haylee on April 27, 2014
  9. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26

    asked by Jenny on November 1, 2009
  10. Geography

    I'm writing a paper about sedimentary rocks. My goal is 700 words but I'm stuck. can someone read this and let me know if I'm overlooking some important facts? ************************************* Sedimentary rocks are rocks that

    asked by pooleboy on October 25, 2009

More Similar Questions