Biology

When making comparison of sequences where some are whole genome sequences while others are partial genome sequences, or a specific glycoprotein sequence, How is it that we are able to make comparisons from these sequences if they all have different lengths?

  1. 👍 0
  2. 👎 0
  3. 👁 98

Respond to this Question

First Name

Your Response

Similar Questions

  1. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT

    asked by Jessica on November 30, 2014
  2. 8th grade science

    For my quiz some of these questions confuse me. Your genome is over 99% identical to every other human on earth. True False 3 points Save All living things on earth share certain identical sequences of bases on their genome. True

    asked by Lina on January 19, 2011
  3. Biology

    Why can viruses of the family of the Poxviridae be genetically modified more easily than viruses of most other viral families? A. Because their genome is smaller. B. Because their genome is made of DNA. C. Because their genome

    asked by Danny on October 2, 2017
  4. biology

    You have isolated the genome from a novel virus and would like to determine its composition. you have three tubes, each containing one of these substance: 1. a protein that degrades double stranded DNA (DNase, tube 1) 2. a protein

    asked by Anonymous on December 4, 2009
  5. Genetics

    Name the term used to describe the phenomenon in which a bacteriophage genome incorporates its genome into the chromosome of the host.

    asked by Anon on February 8, 2012
  6. biology

    Below the human hemoglobin sequence are the first thirty amino acid sequences of several other species’ hemoglobins. Inspect the sequences and answer the following questions: Human) h l t p e e k s a v t a l w g k v n v d e v g

    asked by Kim on April 1, 2012
  7. Maths Please Help

    Let A=a1,a2,…,ak and B=b1,b2,…,bj be sequences of positive integers such that a1≥a2≥⋯ak≥1, b1≥b2≥⋯bj≥1, ∑i=1k ai≤6, and ∑j i=1 bi≤6. For how many ordered pairs of sequences (A,B) satisfying the above

    asked by Mathslover on May 22, 2013
  8. biology

    A bacterium has a genome size of 6.0 X 106 base pairs. There is one Origin of Replication (ORI) and each DNA polymerase catalyzes the addition of 1,000 nucleotides/second. How much time is needed to replicate the entire genome?

    asked by sara on February 20, 2017
  9. psychology

    i need 2 examples of what researchers on the human genome project have already learned a bout the human genome

    asked by Kate on February 7, 2016
  10. Computer Organization and Architecture

    Write a subroutine MEMCMP for performing a byte-by-byte comparison of two sequences of bytes in the main memory. The subroutine should accept three input parameters in registers representing the first address, the second address,

    asked by John Corner on November 30, 2017

More Similar Questions