BIOLOGY

WHAT ARE THE COMPLEMENTARY BASE SEQUENCE FOR THE FOLLOWING DNA MOLECULE: GCCTACGATGCTTGTACTGAA

  1. 👍 0
  2. 👎 0
  3. 👁 188
  1. 1. Never give your real name, town, school, etc. online as that is not safe.
    2. Please use lower-case letters because in computer language, "capital letters" are considered impolite and far more difficult to read.
    3. See if any of the following links will help:

    http://search.yahoo.com/search?fr=mcafee&p=complementary+base+sequence+for+the+DNA++molecule%3A+GCCTACGATGCTTGTACTGAA++

    Sra

    1. 👍 0
    2. 👎 1

Respond to this Question

First Name

Your Response

Similar Questions

  1. Biology

    9. The restriction endonuclease AluI leaves blunt ends on DNA fragments after digestion. These blunt ends a) form hydrogen bonds with the blunt ends of other fragments produced by AluI b) are fully base paired c) have only one

  2. Chemistry

    A DNA template having the base sequence A-G-A-T-G-A would produce a mRNA with a base sequence of ______. A) A-G-A-T-G-A B) U-C-U-A-C-U D) T-C-T-U-C-T E) T-C-T-A-C-A F) A-C-A-U-C-A*** G) T-C-T-G-C-T

  3. ap biology

    The first step in making a protein is transcription of a gene. This occurs in the 1._______of a eukaryotic cell. An enzyme called 2.______ carrres out the process of transcribing RNA from the DNA. It starts at a specific

  4. Biochemisty

    The DNA alpha-helix structure has 566900 complete turns. The average molar mass of one base pair of nucleotides in DNA is approximately 469 g/mol. If the spacing between successive base pairs is about 0.69 nm, and a complete turn

  1. English

    I'd like you to check these sentences grammatically. I also would like you to see if the terminology I used is correct. Help me improve my paragraph, please. 1)DNA contains instructions which decide which proteins a cell will make

  2. biology

    1. What are the three parts that make up a nucleotide? 2. What is the sugar found in DNA? 3. What are the four different bases found in DNA nucleotides? 4. What two parts make up the sides of the DNA “ladder”? 5. What holds

  3. Physics

    The two strands of the helix-shaped DNA molecule are held together by electrostatic forces as shown in the Figure 16-44 in the textbook. Assume that the net average charge (due to electron sharing) indicated on H and N atoms is

  4. Biology (check answer)

    Transcription is similar to DNA replication in all of the following ways except: a) the DNA strands unzip b) the polymerase enzyme is involved c) complementary bases are paired up d) a new strand of mRNA is built from the existing

  1. biology

    Which of the following can result from a DNA mutation? (Select all that apply.) The DNA base-pairing rules change. The genetic information is changed. The structure and function of the proteins coded by the DNA change. A different

  2. Chemistry

    A DNA template having the base sequence A-G-A-T-G-A would produce a mRNA with a base sequence of ______. A) A-G-A-T-G-A B) U-C-U-A-C-U*** C) T-C-T-U-C-T D) T-C-T-A-C-A E) A-C-A-U-C-A

  3. Bio

    17. When errors in nucleotide sequencing occur, a. DNA polymerases replaces the incorrect nucleotide with the correct nucleotide b. enzymes dissolve the incorrect nucleotide so DNA polymerase can add the correct one c. purines

  4. Biology

    Part 1: Genetics – From Genes to Proteins, Mutations (Chapter 10) Overview: Genetic information in DNA is transcribed to RNA and then translated into the amino acid sequence of a Protein. A) Step 1 - Transcription: During the

You can view more similar questions or ask a new question.