please help me

The hemophilia gene is located 12 map units from the red-green colorblindness gene on the X chromosome. Red-green colorblindness is recessive to normal color vision. A woman with normal blood clotting and normal color vision, but whose father was a hemophiliac and whose mother was red-green colorblind, marries a man who is not a hemophiliac and is not colorblind.
What percent of their children will be colorblind and have hemophilia? Show work ?

  1. 👍 0
  2. 👎 0
  3. 👁 252
  1. Please type your subject in the School Subject box. Any other words, including obscure abbreviations, are likely to delay responses from a teacher who knows that subject well.

    1. 👍 0
    2. 👎 0
    👩‍🏫
    Writeacher
  2. The hemophilia gene is located 12 map units from the red-green colorblindness gene on the X chromosome. Red-green colorblindness is recessive to normal color vision. A woman with normal blood clotting and normal color vision, but whose father was a hemophiliac and whose mother was red-green colorblind, marries a man who is not a hemophiliac and is not colorblind.

    What percent of their children will be colorblind and have hemophilia? Show work

    1. 👍 0
    2. 👎 0
  3. Since Jiskha does not have a regular biology tutor, you might try this site.

    http://biology-forums.com/index.php

    http://www.khanacademy.org/
    Scroll down to the Biology section and see if there's a section that'll help.

    If there is a tutor here who can help you with this particular question, I'm sure he/she will add a response.

    1. 👍 0
    2. 👎 0
    👩‍🏫
    Writeacher

Respond to this Question

First Name

Your Response

Similar Questions

  1. Biology

    Genetic Factors in Inheritance Quick Check. 1. What is the definition of epistasis? A. When the allele of one gene changes the genotype of another gene. B. When the allele of one gene changes the phenotype of another gene. C. When

  2. Biology

    Refer to the family pedigree shown here. In generation 1 one parent is affected by the gene mutation and one parent isnt. I generation 2 all three children are affected by the gene mutation. What can you conclude about this gene

  3. Biology

    The gene for red hair is recessive to the gene for black hair.What will be the hair colour of a child if he inherits a gene for red colour from his mother and a gene of black hair from his father?Express with the help of a flow

  4. Special topics in guidance

    Luke is riding a bike. Gene wants the bike and tries to push Luke off. Gene is showing which of the following types of aggression? A. Mild B. Instrumental C. Hostile D. Accidental My answer is B.

  1. Science

    Which statement best describes a dominant gene? A. It Is the Gene that produces mutations. B. It Is a gene that produces desirable traits.** C. It Is the Gene that masks a recessive Gene. D. It Is a gene that Is masked by a

  2. Biology

    If two people with normal vision have a daughter can she be colorblind? I tought that the answer would be no because it is sex linked and the second X in women makes up for the X that is colorblind that she might have but what if

  3. Genetics

    Suppose that gene b is sex-linked, recessive, and lethal. A man marries a woman who is heterozygous for this gene. If this couple had many normal children, what would be he predicted sex ratio of these children?

  4. intro to psychology

    Which one of the following statements about the Human Genome Project is not true? A. Researchers have identified almost all 3 billion units of DNA. B. Locating a gene is the first step to understanding how it works. C. Most human

  1. Science

    A scientist is studying a plant species in which the flower color genes are codominant. The scientist crosses a plant with red flowers and a plants with white flowers. The offspring would most likely have... A. Red flowers B.

  2. biology

    what difference would there be in the product cells at telophase II of the meiosis if there had been one crossing over at a position half way betwwen the huntington disease gene and the centromere from one pair of autosomes

  3. Biology

    Genetic engineering is the manipulation of genes using cloning and transformation to change the gene structure. Genetic engineering has many positive outcomes. For example, A) gene therapy might cure one defect while creating

  4. biology

    so i have this 5-3 gene sequence and i need to transcribe it to a polypeptide and im not sure my trascription is right could someone check gene sequence(ACCTGATGGCCGTTAATCTATTTAAGGCCTGAAGTAACGTATGG)

You can view more similar questions or ask a new question.