science 7A energy and matter in an ecosystem

Similar Questions

1. Bio

   What is the major difference between the position of producers and primary consumers in the food chain? Primary consumers make up the second level of the food chain, while producers make up the third level of the food chain.

2. Science

   Energy Conservation Quick Check 1.Is freezing an endothermic or exothermic process? How do you know?(1 point) Freezing is exothermic because as water bonds into ice, the bonds absorb energy from the environment in order to change

3. science

   1. What type of organism is the grass? * 1 point A Producer B Primary Consumer C Secondary Consumer D Tertiary Consumer 2. Which animal is the herbivore or primary consumer? * 1 point A Rabbit B Fox C Both D Neither 3. Which

4. biology

   1.What is the % concentration of oil in the first, second, and third trophic levels in our food chain? 2.How did the concentration of oil change from one trophic level to the next? 3.How does the change in concentration represent

1. Science

   How does eye location beast represent the relationship between sturcture and function? A- it determines how much of the surroundings an organism can see. B- it affects how an organism interacts with others in its population C- it

2. Biology

   What is true of the energy that is passed from one trophic level to the next in a food chain? A)About 10% of the energy passed from one level to the next is released as heat. B)About 10% of the stored energy of one level becomes

3. Biology

   Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC

4. science

   A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The

1. Environmental Science

   1. A prion is an infectious, self-reproducing protein structure. True X False 2. As one organism eats another, toxins can be spread throughout the food chain. True False x 3. The problem with DDT in the environment is that it

2. Math help

   In which type of symbiotic relationship is one organism helped while another organism is neither benefitted nor harmed? A: Mutualism B: Predation C: Commensalism D: Parasitism

3. Biology B U3 L2 Cycling of Matter and NRG Answers

   Biology B U3 L2 Cycling of Matter and Energy Answers - 1. What is the difference between a detritivore and a decomposer? Answer - While detritivores feed on dead organic matter, decomposers actually break down dead or decaying

4. Physics

   A teacher had her students write down hypotheses about an experiment. Which is a valid hypothesis? A. Energy gets transferred among all the organisms of a food chain B. All living organisms are made from at least one cell C. If

Still need help? You can ask a new question.