Biology

Here are parts of the DNA base sequences for 7 organisms:

Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC

Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG

Organism 3:
GCTAAGCACTACGCTACGTCGCTTAATAGC

Organism 4:
GCTAAGGCACTACGCTACGTCGCATTATAC

Organism 5:
GCCAAGGCACTACGCTACGTCGCATTATAC

Organism 6:
GCTAAGGCACTACGCTACGTCGCTTTATAC

Organism 7:
GCTAAGAGACTACGGAACGCCGCTTAATAG

The question is: Which of the sequences is least likely to lead to a functional part of a protein, and why?

I researched stop codons in DNA and found them to be TAG, TAA and TGA - which doesn't help as pretty much all of the sequences feature one of these at least once.

Any help would be appreciated, thanks!

  1. 👍
  2. 👎
  3. 👁
  1. Since Jiskha doesn't have a biology expert at this time, please try posting your question at this site.

    http://www.biology-online.org/biology-forum/

    In addition, be sure to make really good use of KhanAcademy!
    http://www.khanacademy.org/science/biology
    Choose from the general topics at the right and then find the specifics you need within each topic.

    1. 👍
    2. 👎
    👤
    Writeacher

Respond to this Question

First Name

Your Response

Similar Questions

  1. science

    A _____ organism is the offspring of many generations of organisms that have the same trait. hybrid homozygote purebred crossbred An organism’s physical appearance is its _____. heterozygous phenotype codominance genotype

  2. biology

    What environmental conditions would favor sexual reproduction? What environmental conditions would favor asexual reproduction? Organism - sexual reproduction - gonads asexual reproduction - honeybees - Is pillbugs an asexually

  3. Science

    What is a gene?(1 point) a section of DNA that encodes a specific protein a point that joins two halves of a chromosome a large molecule that performs a specific function a structure that contains many chromosomes Which structure

  4. Science

    1. Unicellular cells must carry out ___ of life. all functions specific functions a single function a few functions 2. Which statement is correct about the movement of unicellular organisms and multicellular organisms? Parts of a

  1. biology

    which of the following is not a characteristic of life A. maintains homeostasis B. composed of cells C. composed of atoms D. carries out metabolism which of the following must be true to consider something to be alive? A. it must

  2. 11Science

    A diploid organism has five pairs of chromosomes in each somatic cell. Assuming that no crossing over occurs, how many genetically distinct gametes can this organism produce?

  3. Science

    A scientist discovered a microscopic, unicellular organism with no nucleus. Which of the following correctly describes the organism? A.The organism is a plant. B.The organism is an animal. C.The organism is a prokaryote.** D.The

  4. Biology help needed bad!

    A biologist discovers a new unicellular organism and classifies it as a prokaryote. The cell is very small, contains a cell membrane, a cytoplasm, DNA in a nucleus, and no other cell organelles. Which statement below represents a

  1. science 1 question

    Explain how a scientist would use DNA or protein sequences taken from three different organisms to construct a cladogram. I know what a cladogram is but I have no clue about the DNA or protien thing. Anything would be helpful.

  2. Science

    Which of the following is not used as evidence when constructing cladograms? a. ecological roles of present-day organisms. b. DNA sequences of present-day organisms. c. fossils of extinct organisms. d. body characteristics of

  3. science

    Organism A has more juxtamedullary nephrons than organism B. which of these organisms could concentrate urine more effectively and why?

  4. science (cladogram)

    How would a scientist use DNA or protein sequences from three different organisms to construct a cladogram?

You can view more similar questions or ask a new question.