science

why is it impossibe for an individual organism to simply "adapt" to a new biome?

Adaptation to a new biome takes generations. When in a new biome, many organisms of a peraticular species will die. However, with adaquate variation within the species, some individuals may have characteristics that allow them to survive and pass those (more adaptive) characteristics to their offspring.

With whatever charaacteristics they already have, each individual will either survive or die within a new biome...or within their old biome.

I hope this helps. Thanks for asking.

asked by sara

Respond to this Question

First Name

Your Response

Similar Questions

  1. Comm 100 college

    The most important principle of language adaptation is to A.adapt the level of language to the situation and the audience. B.adapt to less formal and more colloquial so that all people will understand you. C.adapt to spoken and
  2. Enviornmental Science

    What are some of the climate and physical characteristics of that biome and the types of organisms that live within it. Which biome? Please identify the biome and post your answers. We'll be glad to help you from there.
  3. social studies

    a Do you think it was possible for a native person to adapt to victorian society? was such adaptation necessary ? Was it right? why or why not?
  4. Math

    the concentration of a certain substance in our organism is given by the model Q9t) = Q(subscript 0) e^-0.1960t a) what quantity of substance is present in the organism of this individual 3 hours after ingestion? b) after how many
  5. arctic

    Why is the arctic tundra classified as a biome? Here's a good definition of biome: "Biomes are defined as 'the world's major communities, classified according to the predominant vegetation and characterized by adaptations of
  6. bio

    explain and illustrate how the long-term survival of a species depends on resources that may be limited from time to time. If there is an annual dry season, the organism will adapt by going into estivation (Lungfish) . If its cold
  7. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The
  8. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC
  9. Science

    Why does evolution matters today if it takes millions of years for an organism to change and adapt? Also, does it have to do with genetic variation?
  10. Science

    A population of oak trees growing in a region in Canada experiences a change in climate to much colder temperatures and much drier conditions than they have had for many decades. What determines how this population will change in

More Similar Questions