geometry

predict the next two numders in this sequences:-5,-2,4,13_,_

  1. 👍 0
  2. 👎 0
  3. 👁 55
  1. first difference = 3
    second difference = 6
    third difference = 9
    well I think the next difference will be 12
    so 13+12 = 25 --> next number
    then of course the next difference might be 15 etc

    1. 👍 0
    2. 👎 0
    posted by Damon

Respond to this Question

First Name

Your Response

Similar Questions

  1. Biology

    When making comparison of sequences where some are whole genome sequences while others are partial genome sequences, or a specific glycoprotein sequence, How is it that we are able to make comparisons from these sequences if they

    asked by Cristian on April 21, 2013
  2. math

    hi can you predict the next sequences possible from the numbers 1-50 05 16 20 30 41

    asked by nina on June 27, 2011
  3. biology

    Below the human hemoglobin sequence are the first thirty amino acid sequences of several other species’ hemoglobins. Inspect the sequences and answer the following questions: Human) h l t p e e k s a v t a l w g k v n v d e v g

    asked by Kim on April 1, 2012
  4. Maths Please Help

    Let A=a1,a2,…,ak and B=b1,b2,…,bj be sequences of positive integers such that a1≥a2≥⋯ak≥1, b1≥b2≥⋯bj≥1, ∑i=1k ai≤6, and ∑j i=1 bi≤6. For how many ordered pairs of sequences (A,B) satisfying the above

    asked by Mathslover on May 22, 2013
  5. King

    Oder the numders from least to greastest 3/8 5^-3 0.003 square root of 5 4/7

    asked by Niema on January 3, 2013
  6. algebra

    For each of the following sequences, find an explicit and a recursive description of the pattern. Assume sequences start from n = 1. a. 1, -1, -3, -5... b. 8,2,3,9... c. -2, 0, 0, -2, -6...

    asked by Sara V. on May 3, 2017
  7. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC

    asked by Maria on October 28, 2016
  8. math

    1. Examine the first four terms in each of the following number sequences: *2, 7, 12, 17 my formula x+5 *7, 21, 63, 189, 567 my formula x(2)+x *1000, 850, 700, 550 my formula x-150 * –10, –6, –2, 2 my formula x+4 For each

    asked by cindy on June 17, 2016
  9. biology

    Explain how the sequences of the newly created daughter DNA sequences compare to the original parent DNA sequence. And why do they look that way?

    asked by Help please or give me a website where I can find on March 14, 2018
  10. math

    How many n-digit decimal sequences (using digits 0-9) are there with k 1s? Decimal sequences meaning you can have as many 0s in front of a number. For example: 000001234557891111 would be consider valid. So how do i come up with

    asked by Aisha on October 15, 2006

More Similar Questions