Bio

What is an advantage of using an organism's scientific name rather then its common name?
A.The scientific name is always given in the native language
B.The scientific name is based upon the organism's kingdom and phylum
C.The scientific name does not depend on any classification system
D.The scientific name clearly identifies the organism

A?

  1. 👍 0
  2. 👎 0
  3. 👁 105
  1. Not A.

  2. D.

    All scientific names identify an organism's genus and species. Usually this name is Latinate (interesting-ish story involving Linnaeus), though it doesn't have to be.

    1. 👍 0
    2. 👎 0
    posted by Alex
  3. I'm not really sure. Because I don't think it's D or B so is it C?

    1. 👍 0
    2. 👎 0
  4. Ohh

    1. 👍 0
    2. 👎 0
  5. It's not C.

    Please do not post this question again. You're on your own now.

  6. I really thought it was A because C was my second option. Because it shouldn't be D because the scientific name doesn't clearly give the identity of an organism (for example Ursus maritimus doesn't give out the identity)
    But it can't be C now that I look at it again because it does depend on a classification system.
    I didn't think it was B because the names aren't like the kingdoms and phylum and A made the most sense to me because ursus means bear in another language and homosapien is latin for human.

    1. 👍 0
    2. 👎 0
  7. Ah, but each scientific name is unique. Chip brand names may be ridiculous-- Lay's, Doritos, Cheetos, etc.-- but they're unique so they still serve as good identifiers. (Can you tell I'm sitting next to a vending machine?)

    (Fun fact, ursus is also Latin-- most things that end in "us" are Latin. And homo sapiens is literally "wise man." We humans hold high opinions of ourselves. :D)

    1. 👍 0
    2. 👎 0
    posted by Alex
  8. Ohh but how does the scientific name being unique make D the correct answer?

    1. 👍 0
    2. 👎 0
  9. Each organism has its own scientific name.

  10. Because unique identifiers mean that, given a name, someone could find out about the organism.

    If we had two things with the scientific name "cat," that would be a problem-- there are tons of cats. But since no two species of cats have the same two names, given a scientific name, we can easily research more about the animal. We might not be taxology buffs and intuitively know every scientific name, but we could find out. "Clearly identify" doesn't mean that your average person can identify the organism from its scientific name, it means that you could find out more about the organism given the name. "Black-throated sparrow" could give you a lot of results, but Amphispiza bilineata is pretty specific.

    1. 👍 0
    2. 👎 0
    posted by Alex

Respond to this Question

First Name

Your Response

Similar Questions

  1. Science

    What is the main benefit of using scientific names instead of common names for organisms?   Scientific names have been around for much longer than common names have. Scientific names give everyone a shared terminology while

    asked by Anne on April 18, 2014
  2. Science

    What makes up the scientific name of an organism? Why is it important to use scientific names rather than common names?

    asked by Ashley on June 7, 2009
  3. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The

    asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! on May 7, 2014
  4. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC

    asked by Maria on October 28, 2016
  5. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26

    asked by Jenny on November 1, 2009
  6. Science

    How does eye location beast represent the relationship between sturcture and function? A- it determines how much of the surroundings an organism can see. B- it affects how an organism interacts with others in its population C- it

    asked by Skye on September 19, 2014
  7. Science Fossils

    When might preserved remains of an entire organism form? A. When sediment buries the hard part of an organism. (this one) B. When an event such as quick burial or freezing preserves an entire organism. C. When minerals replace

    asked by Anonymous on October 3, 2013
  8. Science

    1.) when might preserved remains of an entire organism form? A.) when sediment buries the hard part of an organism B.) when an event such as a quick burial or freezing preserves an entire organism ******* C.) when minerals replace

    asked by Zach on February 29, 2016
  9. Biology!!

    1. what's a huge difference between the chemical equations for Respiration and Alcoholic fermentation &... What determines whether a facultative organism will go through respiration or fermentation *For the first part of the

    asked by Jess on May 16, 2017
  10. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and

    asked by dion on September 30, 2008

More Similar Questions