science (URGENT!! CORRECT PLEASE))

(1) in order for an organism to develop specialized tissues the organism must be which of the following

A) A Plant

B) An Animal

C) Unicellular

D) Multicellular

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

My answer: D

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

(2) Which foods are lipids found in, and what is their function in the body?

A) lipids are found in sugars and starches and are the main source of energy for the body

B) lipids are found in fats and oils and are an essential component of cell membranes

C) lipids are found and fats and oils and they speed up chemical reactions in the body

D) lipids are inorganic nutrients such as calcium iron and potassium and are found in meats, dairy products, and nuts.

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

My answer: A


~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

(3) which of the following is the most complex level of cell organization

A) Cell

B) Organ

C) Organisim

D) Tissue


~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

My answer: B

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

  1. 👍 0
  2. 👎 0
  3. 👁 414
  1. My guess is that the answers are:
    D
    B
    C

    1. 👍 0
    2. 👎 0
    posted by Sydney
  2. yes, thank you~!

    1. 👍 0
    2. 👎 0
  3. Did you get the answers right?

    1. 👍 0
    2. 👎 0
    posted by Sydney
  4. I did. thank you.

    1. 👍 0
    2. 👎 0
  5. 1. Which of the following shows the correct order of of cell organization starting from the least complex

    1. 👍 0
    2. 👎 0
  6. The correct order of cell organization is Cells, tissue organs organ system.

    1. 👍 0
    2. 👎 0
    posted by Anon

Respond to this Question

First Name

Your Response

Similar Questions

  1. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The

    asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! on May 7, 2014
  2. Science Please helpppp me!!

    (1) in order for an organism to develop specialized tissues the organism must be which of the following A) A Plant B) An Animal C) Unicellular D) Multicellular*** (2) Which foods are lipids found in, and what is their function in

    asked by Abigail on September 19, 2017
  3. Biology

    2. The advantages of vascular tissue over nonvascular tissue are evident in a. whether organisms have alternation of generations b. an organism's size and complexity c. the number of individual offspring produced by each organism

    asked by mysterychicken on March 1, 2010
  4. Biology

    2. The advantages of vascular tissue over nonvascular tissue are evident in a. whether organisms have alternation of generations b. an organism's size and complexity c. the number of individual offspring produced by each organism

    asked by mysterychicken on March 1, 2010
  5. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC

    asked by Maria on October 28, 2016
  6. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26

    asked by Jenny on November 1, 2009
  7. Science

    How does eye location beast represent the relationship between sturcture and function? A- it determines how much of the surroundings an organism can see. B- it affects how an organism interacts with others in its population C- it

    asked by Skye on September 19, 2014
  8. Science Fossils

    When might preserved remains of an entire organism form? A. When sediment buries the hard part of an organism. (this one) B. When an event such as quick burial or freezing preserves an entire organism. C. When minerals replace

    asked by Anonymous on October 3, 2013
  9. Science

    1.) when might preserved remains of an entire organism form? A.) when sediment buries the hard part of an organism B.) when an event such as a quick burial or freezing preserves an entire organism ******* C.) when minerals replace

    asked by Zach on February 29, 2016
  10. 5th grade

    a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you notice that it develops somewhat like a grasshopper. explain how you would classify this organism, and

    asked by dion on September 30, 2008

More Similar Questions