science (URGENT!! CORRECT PLEASE))

(1) in order for an organism to develop specialized tissues the organism must be which of the following

A) A Plant

B) An Animal

C) Unicellular

D) Multicellular

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

My answer: D

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

(2) Which foods are lipids found in, and what is their function in the body?

A) lipids are found in sugars and starches and are the main source of energy for the body

B) lipids are found in fats and oils and are an essential component of cell membranes

C) lipids are found and fats and oils and they speed up chemical reactions in the body

D) lipids are inorganic nutrients such as calcium iron and potassium and are found in meats, dairy products, and nuts.

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

My answer: A


~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

(3) which of the following is the most complex level of cell organization

A) Cell

B) Organ

C) Organisim

D) Tissue


~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

My answer: B

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

asked by Yuno Gasai
  1. My guess is that the answers are:
    D
    B
    C

    posted by Sydney
  2. yes, thank you~!

    posted by Yuno Gasai
  3. Did you get the answers right?

    posted by Sydney
  4. I did. thank you.

    posted by Yuno Gasai
  5. 1. Which of the following shows the correct order of of cell organization starting from the least complex

    posted by Annonymous
  6. The correct order of cell organization is Cells, tissue organs organ system.

    posted by Anon

Respond to this Question

First Name

Your Response

Similar Questions

  1. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The
  2. Science Please helpppp me!!

    (1) in order for an organism to develop specialized tissues the organism must be which of the following A) A Plant B) An Animal C) Unicellular D) Multicellular*** (2) Which foods are lipids found in, and what is their function in
  3. Biology

    2. The advantages of vascular tissue over nonvascular tissue are evident in a. whether organisms have alternation of generations b. an organism's size and complexity c. the number of individual offspring produced by each organism
  4. Biology

    2. The advantages of vascular tissue over nonvascular tissue are evident in a. whether organisms have alternation of generations b. an organism's size and complexity c. the number of individual offspring produced by each organism
  5. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC
  6. Science

    A biologist is studying the epithelial cells in a variety of plants and animals. She counts the chromosomes in the epithelial cells of several organisms and finds the following numbers: Organism A: 32 chromosomes Organism B: 26
  7. Science

    How does eye location beast represent the relationship between sturcture and function? A- it determines how much of the surroundings an organism can see. B- it affects how an organism interacts with others in its population C- it
  8. Science

    1.) when might preserved remains of an entire organism form? A.) when sediment buries the hard part of an organism B.) when an event such as a quick burial or freezing preserves an entire organism ******* C.) when minerals replace
  9. Science Fossils

    When might preserved remains of an entire organism form? A. When sediment buries the hard part of an organism. (this one) B. When an event such as quick burial or freezing preserves an entire organism. C. When minerals replace
  10. Biology

    Which organism is a third-order heterotroph? To what trophic level does that organism belong?

More Similar Questions