Questions LLC
Login
or
Sign Up
Ask a New Question
Science
Biology
Organisms
what is an organism and how do i do a report on how to explain one
1 answer
http://en.wikipedia.org/wiki/Organism
You can
ask a new question
or
answer this question
.
Similar Questions
a new organism is found that is multicellular, does not have a backbone, and has six legs. while studying the organism, you
Top answer:
Assistance needed.
Read more.
A scientist discovered a microscopic, unicellular organism with no nucleus. Which of the following correctly describes the
Top answer:
Lesson 3:Science 6B Mini Module Test Unit 4 1:C 2:D 3:C 4:B 5:C 6:D 7:abiotic 8:Do you’re self
Read more.
Explain what method of output would be best for each of the following situations and explain why: hand held computer, color
Top answer:
Please note that <b>we don't do students' homework</b> for them. Our tutors try to give you the
Read more.
Which statement describes a consumer/producer relationship?(1 point)
Responses One organism catches and consumes another
Top answer:
One organism that benefits from living in or on another organism at the expense of that organism.
Read more.
Which statement describes a consumer/producer relationship?
Both organisms benefit from each other. One organism that benefits
Top answer:
One organism eats another organism that makes its own food.
Read more.
A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following
Top answer:
so the answer is A.
Read more.
Here are parts of the DNA base sequences for 7 organisms:
Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2:
Top answer:
Since Jiskha doesn't have a biology expert at this time, please try posting your question at this
Read more.
Which statement describes a consumer/producer relationship?
A. One organism eats another organism that makes its own food. B. One
Top answer:
C. Both organisms benefit from each other.
Read more.
which statement describes a consumer/producer relationship?
A) Both organisms benefit from each other. B) One organism catches
Top answer:
A) Both organisms benefit from each other.
Read more.
Which statement describes a consumer/producer relationship?
A. One organism eats another organism that makes its own food. B. One
Top answer:
C. Both organisms benefit from each other.
Read more.
Related Questions
Which of the following reports is best suited for a time order/chronological or sequence structure?
a report on preventing
Which report would best be organized in chronological order?(1 point)
Responses a report about the benefits of exercise a report
Which report would best be organized in chronological order?(1 point)
Responses a report about the ways to prevent wildfires a
Which report would best be organized in chronological order?(1 point) Responses
A.a report that reviews two films about the same
A student uses a microscope to study a unicellular organism. He sees that the organism has extended a pseudopod. What is the
which of the following is a medical report that indicates an individual's level of hearing loss?
A. audiogram B. audiograph C.
A) Your teacher describes an organism that digests its food externally before absorbing it. You also find out that this organism
Which report would best be organized in chronological order?
1. A report about the benefits of exercise 2. A report about the
1. Which report would best be organized in chronological order?
* 1 point a report that reviews two films a report about the ways
Which report would best be organized in chronological order?(1 point)
Responses a report about the benefits of exercise a report