Genome A
5�-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG
CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT
GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC
GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3�
Genome B
5�-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT
CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC
CGGCCGGCCTAGATTTACCGCATTTACCGGCCGCATCG
GATCGGGATTAGCATAATTAAAATGCATCGGCGTAGTAG
GCAATCGGCGCAGCCGAGCCACCTCCCGGAGAATCATC
ATCATCATCATCATCATCATCATCATCATCATCATACGGAT
AGATCCATTACCATGCGATTTAAAGGCCATTCATGGGC
CCCCGATTTATCCATTTAGGCCGGATTCCATGGATTCAT
TTCCATTTTTCGGCATCATCATCATCATCATCATCATCAT
CATCATCATCATCATCATCAT -3�
(a) Based on the size of the genome, which of the
sequences would you consider eukaryotic and which
prokaryotic? Justify your answer.
(b) The prokaryotic genome contains one ten base pair
promoter region, whereas the eukaryotic genome
contains two. Find these regions and circle them.
How do you know these are the promoter regions?
(c) Which of the two genomes has telomeric DNA? How
do you know? Circle the telomeric region.
(d) Does the eukaryotic genome contain any microsatellites?
Circle the areas if they exist. What sort of
sequence is found in a microsatellite region?
(e) Identify the areas that may be sequences that code for
a gene in both genomes. Identify the difference
between the eukaryotic and prokaryotic sequences.
How many genes are found in the eukaryotic
genome? (Hint: Look for start codons.)
please tell me how to get the answer, what should i be looking for when locating these
(a) To determine whether a sequence is eukaryotic or prokaryotic, we can look at the size of the genome. Eukaryotic genomes are generally larger in size compared to prokaryotic genomes. In this case, Genome A has a size of 77 base pairs (bp), while Genome B has a size of 172 bp. Given that Genome B is larger, we can consider it as eukaryotic, and Genome A as prokaryotic.
(b) To find the promoter regions, we need to look for the sequence that indicates the beginning of a gene. In prokaryotes, the promoter region typically contains a specific sequence called the -10 element and the -35 element. In eukaryotes, the promoter region usually contains a TATA box.
For Genome A:
The promoter region is likely to be located before the start codon (ATG). In this case, we can see the sequence "CCAT" at the beginning of the genome (5'-CCAT-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG). We can circle this sequence as a potential promoter region. However, without more information, we cannot be sure if this is the actual promoter region.
For Genome B:
The promoter regions may also be located before the start codons. In this case, we can see two potential promoter regions: "GCAT" at the beginning of the genome (5'-GCAT-GCACCCAAATTAATAACGGCGGTAGGCGACTCATT) and "ATG" before "ATCATCATCATCATCATCATCATCATCATCATCATACGGAT" (5'-GATCATCATCATCATCATCATCATCATCATCATACGGAT-ATG).
To confirm the promoter regions, further analysis such as experimental validation or computational prediction tools specifically designed for promoter identification would be required.
(c) Telomeric DNA is found at the ends of chromosomes and is important for maintaining chromosome stability. In this case, we need to locate sequences that resemble telomeric repeats, which are typically tandem repeats of short DNA sequences.
For Genome A:
Based on the given sequence, we don't see any repeats at the ends that resemble telomeric sequences. Therefore, Genome A does not appear to have telomeric DNA.
For Genome B:
At the very end of the genome (5'-CATCATCATCATCATCATCATCATCATCATCATCATCA-TG), we see a repeat of the sequence "CAT." This resembles a telomeric repeat, indicating that Genome B has a telomeric region.
We can circle the sequence "CAT" at the end to indicate the telomeric region.
(d) Microsatellites, also known as short tandem repeats (STR), are repeated DNA sequences consisting of 2 to 6 base pairs. To identify microsatellite regions, we need to look for repetitive sequences in the genomes.
For Genome A:
There are no obvious repetitive sequences in the given sequence of Genome A.
For Genome B:
We can identify a potential microsatellite region in the sequence "CATCATCATCATCATCATCATCATCATCATCATCAT" (5'-CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT-). The repeated sequence "CAT" is circled to indicate the microsatellite region.
The sequence "CAT" is a repeat of the tri-nucleotide "CAT," which is typical for microsatellite regions.
(e) To identify areas that may code for genes, we need to look for start codons, which typically indicate the beginning of a protein-coding region.
For both genomes:
Start codons in DNA are usually represented by "ATG." By scanning through the sequences, we can locate the presence of "ATG."
For Genome A:
There is one occurrence of "ATG" in the sequence "GATATGCATCGTAATCCGGTAGATTCACAGGTAG" (5'-GATATGCATCGTAATCCGGTAGATTCACAGGTAG-).
For Genome B:
There are four occurrences of "ATG" in the following sequences:
1. "ATG" before "ATCATCATCATCATCATCATCATCATCATCATCATACGGAT" (5'-GATCATCATCATCATCATCATCATCATCATCATCATACGGAT-ATG).
2. "ATG" before "AGATCCATTACCATGCGATTTAAAGGCCATTCATGGGC" (5'-AGATCCATTACCATGCGATTTAAAGGCCATTCATGGGC-ATG).
3. "ATG" before "ATTTTTCGGCATCATCATCATCATCATCATCATCATCATCATCATCAT" (5'-ATTTTTCGGCATCATCATCATCATCATCATCATCATCATCATCATCAT-ATG).
4. "ATG" before "CATCATCATCATCATCATCATCATCATCATCATCATCA" (5'-CATCATCATCATCATCATCATCATCATCATCATCATCA-ATG).
The eukaryotic genome (Genome B) has four genes based on the presence of start codons, while the prokaryotic genome (Genome A) has one gene.
(a) To determine whether a sequence is eukaryotic or prokaryotic, we need to consider the size of the genome. Eukaryotic genomes tend to be larger in size, typically ranging from millions to billions of base pairs. Prokaryotic genomes, on the other hand, are usually smaller, ranging from thousands to millions of base pairs.
To identify the size of the genomes in this case, we can count the number of base pairs in each sequence provided. Genome A has 93 base pairs, while Genome B has 218 base pairs. Based on this information, we can conclude that Genome B (with the larger size of 218 base pairs) is likely eukaryotic, while Genome A (with the smaller size of 93 base pairs) is likely prokaryotic.
(b) To locate the promoter regions, we need to look for specific patterns that are commonly associated with these regions. In prokaryotes, a common promoter region consists of a DNA sequence called the -10 region (also known as the TATA box), which has the consensus sequence "TATAAT." In eukaryotes, there are two main types of promoter regions: the core promoter and the regulatory promoter. The core promoter typically contains a TATA box sequence, which is similar to the prokaryotic -10 region.
In both genomes, we need to search for the TATA box sequence or similar patterns. By examining the sequences provided, we can look for the presence of the consensus TATA box sequence "TATAAT" or similar patterns in each sequence. Once located, we can circle these regions as the promoter regions.
To determine whether these are the promoter regions, we can compare the identified regions with known promoter sequences or consult databases or literature to verify their function as promoter regions.
(c) Telomeric DNA is typically found at the ends of chromosomes in eukaryotes. It consists of repetitive sequences that help protect the integrity of the chromosome ends. Prokaryotes, on the other hand, do not possess telomeric DNA, as their chromosomes are circular and do not have distinguishable ends.
By examining the provided sequences, we can search for repetitive sequences at the ends of any of the genomes. If repetitive sequences are found at the ends of Genome B, we can circle those regions as the telomeric regions. However, since Genome A is prokaryotic, we would not expect to find telomeric DNA in it.
(d) Microsatellites are short, repeating sequences found throughout genomes. To identify microsatellites, we need to search for regions where a short sequence is repeated multiple times consecutively. The most common motif in microsatellites is the repetition of di- or trinucleotide sequences, such as "ATATAT" or "CACACACA."
By carefully examining both genomes, we can circle regions where short sequences are repeated multiple times consecutively, indicating the presence of microsatellites. Additionally, we can note the specific sequence motif found in each microsatellite region.
(e) To identify sequences that code for genes, we need to search for regions that contain start codons. In both prokaryotes and eukaryotes, the most common start codon is AUG (codes for methionine).
By scanning both genomes, we can look for regions where the sequence starts with the codon AUG, indicating the presence of a potential gene. We can circle those regions and note them as potential gene-coding areas. Additionally, we can compare the identified gene-coding regions between the eukaryotic and prokaryotic genomes to find any differences.
To determine the number of genes in the eukaryotic genome, we can count the number of start codons (AUG) found in the identified gene-coding areas. Each start codon represents the potential initiation of a gene.