The mRNA sequence of nucleotides for gene "Y" has been determined to be AGCCAUGCCCGCGAGGUAGAAA. You have decided to mutate the gene, such that a new and functional protein is expressed from this gene. To do this, you have placed the nucleotide sequence_______ after the codon CCC in the RNA sequence.

Question

The mRNA sequence of nucleotides for gene "Y" has been determined to be AGCCAUGCCCGCGAGGUAGAAA. You have decided to mutate the gene, such that a new and functional protein is expressed from this gene. To do this, you have placed the nucleotide sequence_______ after the codon CCC in the RNA sequence.

1. AGUCAUCGU
2. GUCAUCGU
3. GTCATCGT
4. AGTCATCGT

I believe the answer is 4 because C is stustituted with T but I am not sure.

Perhaps the following link will help you:

http://en.wikipedia.org/wiki/Codon

Answer 1

To determine the correct answer, we need to understand the role of codons in protein synthesis. Codons are sequences of three nucleotides in mRNA that specify a particular amino acid. Each codon codes for a specific amino acid or serves as a start or stop signal for protein synthesis.

In this question, we are asked to place a nucleotide sequence after the codon CCC. Let's find the codon CCC in the given mRNA sequence: AGCCAUGCCCGCGAGGUAGAAA.

The sequence AGCCAUGCCCGCGAGGUAGAAA can be divided into codons as follows:
AGC CAU GCC CGC GAG GUA GAA

The codon CCC is located in the middle as CGC. We need to place a nucleotide sequence after this codon to ensure that a new and functional protein is expressed.

Now, let's evaluate the answer choices:

1. AGUCAUCGU: This sequence does not match the requirement because it is not placed after the codon CCC (CGC).

2. GUCAUCGU: Similar to option 1, this sequence does not match the requirement as it is not placed after the codon CCC (CGC).

3. GTCATCGT: This sequence does not match the requirement because it does not consider the existing codon CCC (CGC).

4. AGTCATCGT: This sequence does match the requirement as it is placed after the codon CCC (CGC).

After evaluating all the options, option 4 (AGTCATCGT) is the correct answer because it correctly places a nucleotide sequence after the codon CCC (CGC), ensuring a new and functional protein is expressed.

Keep in mind that this question is not testing your knowledge of nucleotide bases, but rather your ability to locate and modify codons within an mRNA sequence.