English

Punctuation commas
Scientist have mapped the human genome. They learn more every day about how genes affect an individual's health.
My answer
Scientist have mapped the human genome, so they learn more every day about how genes affect and individual's health.

  1. 👍 0
  2. 👎 0
  3. 👁 158
  1. I guess "so" works OK here, but I'd be inclined to use "and" -- your comma placement is correct.

    1. 👍 0
    2. 👎 0
  2. Thank you

    1. 👍 0
    2. 👎 0
    posted by antonio

Respond to this Question

First Name

Your Response

Similar Questions

  1. Science

    Q1: Why do scientist use models? A.) Scientist use models to learn about things that are too small, too late, or too complex to observe directly. B.) Scientist use models because doing so is always part of the scientific method.

    asked by Help please on September 1, 2016
  2. psychology

    i need 2 examples of what researchers on the human genome project have already learned a bout the human genome

    asked by Kate on February 7, 2016
  3. intro to psychology

    Which one of the following statements about the Human Genome Project is not true? A. Researchers have identified almost all 3 billion units of DNA. B. Locating a gene is the first step to understanding how it works. C. Most human

    asked by elly on June 24, 2015
  4. Health (Ms. Sue)

    1. What are two ways that society could deal with future concerns about genetic information? A: ? 2. Imagine you are a scientist working on the Human Genome Project. What would you say to news reports about your research? A: ?

    asked by Anonymous on November 29, 2013
  5. Biology

    Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT

    asked by Jessica on November 30, 2014
  1. SCIENCE

    HOW DO YOU REMEMBER WHICH GENES ARE WHICH! What do you mean which genes are which? There are thousands of genes and it all depends on the organism.... What kind of genes? human genes? plant genes? Go to www.google.com and type in

    asked by AMBER on December 25, 2006
  2. Biology

    Humans have about 20,000 genes in our genome. Explain how cells differentiate into different kinds of cells even though they have the same set of 20,000 genes in their nuclei, so they are genetically identical.

    asked by Student on April 12, 2013
  3. Biology

    The original high estimate of the number of protein-coding genes in humans was based partly on the number of different known proteins made by the human organism. How can the small number of genes now thought to be present account

    asked by arthur on March 25, 2013
  4. English

    Can somebody help me with commans? where do they commas go in these sentences? Or do they need them? 1) I give you homework becuase you need to learn commas. 2)If you fill in the commas you will be happy with your grade. 3) I will

    asked by Jen on January 28, 2010
  5. Biology

    Why can viruses of the family of the Poxviridae be genetically modified more easily than viruses of most other viral families? A. Because their genome is smaller. B. Because their genome is made of DNA. C. Because their genome

    asked by Danny on October 2, 2017

More Similar Questions