
If one strand of DNA has a nucleotide base sequence of TCAGGTCCATAT, What is its complement base sequence? If the above is the DNA template strand, what is the corresponding RNA nucleotide base sequence? How many amino acids are coded for on the segment of RNA?

  1. 👍 0
  2. 👎 0
  3. 👁 41
asked by Ted
  1. This is more biology or genetics than anthropology. These letters do indeed stand for nitrogeneous bases, but you need to know the rules for how the hydrogen bonds work. These bases are always paired up in the same fashion.
    For DNA, adenine and cytosine always travel together as do cytosine and guanine. For RNA, you still have cytosine and guanine coupled together. However, RNA has a base known as uracil instead of thymine that bonds with adenine. I can not remember how exactly the processes of transcription and translation assemble protiens from amino acids, but this is something that I never had to memorize. To get you started, just remember that DNA is the master blueprint that sends out messenger RNA which in turn sends out transfer RNA.

    1. 👍 0
    2. 👎 0
    posted by Brandon
  2. Ted, I will be happy to check your work. As Brandon pointed out, the complements are well known, and are in his post.

    1. 👍 0
    2. 👎 0
    posted by bobpursley

Respond to this Question

First Name

Your Response

Similar Questions

  1. Biology

    14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of

    asked by mysterychicken on February 3, 2010
  2. Biology

    14. The major components of a DNA molecular subunit are a. a chromosome, deoxyribose, and double helix b. a five-carbon sugar, phosphate group, and a nitrogen-containing base c. adenine, guanine, cytosine, and thymine d. all of

    asked by mysterychicken on February 4, 2010
  3. BIO 12

    BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would

    asked by Stephanie on September 24, 2015
  4. Biology

    I am totally confused by what to do here: GGG CAT GGT CCT ATT TAC DNA coding strand sequence: DNA non-coding strand sequence: mRNA sequence: Amino acid sequence:

    asked by Jen on October 31, 2007
  5. Genetics

    Given the sequence of bases in the sense strand of DNA shown below, please answer the following questions. 5'-ATGTTTCCCCAGAAGAGGTATGGGAAAAAGATTTGA-3' a. Show the sequence of bases in the messenger RNA encoded by this gene. I'm not

    asked by Jenna on November 4, 2009
  6. chemistry

    The total mass of DNA in the body is 50.0 g. If the number of nucleotides in ONE STRAND of DNA is approximately 3.0 x 106, and the average length of a single nucleotide is 0.34 nm, what is the length (in km) of one strand of DNA

    asked by jenna on May 10, 2016
  7. Biology

    Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3'-5' and the other 5'-3'. For each DNA sequence given below, write the mRNA sequence that would be coded from it. Make

    asked by Danielle on March 23, 2014
  8. science

    Lisof a strand of the base sequence of a strand of RNA made using the DNA pattern ATCCGTC. Can you please help me

    asked by Gaby on February 24, 2009
  9. Science

    The following DNA sequence represents a eukaryotic gene. Indicate which is the template and which is the coding strand, determine where transcription begins (assume it ends at the end of the sequence presented), write out the

    asked by HomeworkHatesMe on March 7, 2012
  10. Biology

    Kay so these are the strands of DNA 5' C C A G T A G T T 3' 3' G G T C A T C A A 5' Let's say the DNA molecule above were the parent strand of DNA. when the strands are split for replication, which strand would be the template for

    asked by Melanie on February 21, 2011

More Similar Questions