Biology
- 👍
- 👎
- 👁
- ℹ️
- 🚩
-
- 👍
- 👎
- ℹ️
- 🚩
👤Writeacher
Respond to this Question
Similar Questions
-
Calculus
A solid is formed by adjoining two hemispheres to the ends of a right circular cylinder. An industrial tank of this shape must have a volume of 1600 cubic feet. The hemispherical ends cost twice as much per square foot of surface -
Biology
1- the first step in manipulating and extracting DNA from cells is to _____ it into smaller pieces for analysis. 2- the second step in manipulating and extracting DNA from cells is to ______ it based on size using gel _______. 3- -
Biology
Which of the following . is true about the DNA molecule during transcription? A- It opens up all of the way, one gene at a time. B- It unwinds from both ends. C- It makes a copy of itself. D- Only a small area is opened. My choice -
Analytic Geometry
Find the coordinates of the foci, the ends of major and minor axis, the ends of latus rectum then sketch the graph of y^2/169 + x^2/144 =1 (i need the anwers to that i will have an idea on how to solve the remaining .)
-
Biology
Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3'-5' and the other 5'-3'. For each DNA sequence given below, write the mRNA sequence that would be coded from it. Make -
Calculus - Optimization
A parcel delivery service a package only of the length plus girth (distance around) does not exceed 24 inches. A) Find the dimensions of a rectangular box with square ends that satisfies the delivery service's restriction and has -
biology
(c) Given the DNA shown below … 3’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 5’ 5’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 3’ i) If this DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence -
English
Write a paragraph in which you compare and contrast the motivations of Brutus and Cassius, and determine whether the ends justify the means. ("The ends justify the means" is simply saying that the good results, or "ends," make it
-
english
read the following passage from the poem "eve to her daughters" it was not i who began it turned out into draughty caves, hungry so often, having to work for our bread, hearing the children whining, i was nevertheless not unhappy. -
Mathematics
Fig 12.34 Shows a wire clip of radius 7mm with a gap of 7mm between the ends. calculate the nearest mm,given about 4mm are used altogether in making the turnovers at the ends -
Biology PleaSE help!
Hello, this is my biology assignment. I filled the answer's but I just need your help to correct me if I'm wrong Thank you. 1) The discovery of restriction endonucleases was crucial to the development of recombinant DNA technology -
english
Hey I have the write the sentences in passiv. But I do not really be good in passiv... can anybody check and may axplain what passiv is? The extent of the flood-damage has surprised everyone. -> Everyone was surprised by the
Still need help? You can ask a new question.