scienc

the enivronment that is most favorable to an organism,s survival is its
range of tolerance
optimum conditions
preferred environment
best conditions

  1. 👍 0
  2. 👎 0
  3. 👁 88
asked by bertha
  1. range of tolerance because the organism has to react to it's environment. It can't control it.

    1. 👍 0
    2. 👎 0
    posted by Doug

Respond to this Question

First Name

Your Response

Similar Questions

  1. Biology

    What is the difference between tolerance range and optimum range in Biology?

    asked by Elizabeth on January 27, 2016
  2. science

    An organism's ability to maintain homeostasis is important to it's survival. Explain why an organism that lives on land has more complex mechanisms to maintain a stable internal environment than organims that live in water.

    asked by Jaci on September 21, 2010
  3. 10th grade

    A specific structure in a single-celled organism.How the structure is involved in the survival of the organism?

    asked by L-Starz on July 9, 2009
  4. science

    A transmission electron microscope was used to examine a microscopic organism. No nucleus was found. Which of the following correctly describes the organism? A. The organism is a prokaryote. B. The organism is a eukaryote. C. The

    asked by I NEED HELP FAST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! on May 7, 2014
  5. Math (Grade 11)

    1) The measurement is 15.5, the tolerance is 5. Whats the precision, uncertainty, range, nominal value and precent error? 2) The measurement is 14.5, the tolerance is 6. Whats the precision, uncertainty, range, nominal value and

    asked by Kelly on October 26, 2016
  6. Science

    Which statement is true of an organ system? A. It supports all part of the organism. B. it is not necessary for the survival of the organism. C. One organ system can take over for another organ system. D. It has no connection with

    asked by Daisy on February 17, 2015
  7. biology

    Why all enzyme work well in their own optimum temperature and optimum pH ? i need more explanation about why different enzyme have different optimum temperature and different optimum pH to react. i hope to get a long explanation

    asked by kate on July 31, 2013
  8. Science

    I need some help, this is fairly confusing to me. ______ Allows traits favorable for survival to be passed from parents to offspring. I could not find the answer to this in my textbook, any help?

    asked by Bluue on October 3, 2015
  9. Biology

    Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC

    asked by Maria on October 28, 2016
  10. 9 th science

    distinguish between tolerance range and optimal range

    asked by jin on September 13, 2010

More Similar Questions