Posts by maria

Total # Posts: 2,034

Analytical Physics II
A charged cloud system produces an electric field in the air near Earth's surface. A particle of charge -2.1 x 10-9 C is acted on by a downward electrostatic force of 4.3 x 10-6 N when placed in this field. (a) What is the magnitude of the electric field? (b) What is the ...

algrebra 1
simplify the square root of ( 18x^2 divided by 50) thank you I tried doing like 9x2x^2 divided by 25 x2...then i got stuck thank you so much...my mom and dad can't help me with this kind of stuff

pre algrebra
I still don't get the end part

pre algrebra
thank you, Scott or whomever simplify the square root if 108 ok. I got 9x12 which then prime factorization = 2.2.3.3.3 then i get it means the square root of 2.2.3.3.3 but then i get stuck thank you

algebra 1
is the set of all positive integers closed under addition? if yes..give 2 examples if no,,,give 2 examples that prove it is not

algebra
?120 inch length of ribbon is to be cut into three pieces. The longest piece is to be 40 inches longer than the shortest? piece, and the third piece is to be half the length of the longest piece. Find the length of each piece of ribbon.

math
Communicate how can you find what each mark represents on a number line

math 9th grade
if xy is rational must either x or y be rational

help scott biostats
The proportion of deaths due to lung cancer in males ages 15-64 in England and Wales during the period 1970-1972 was 12%. Suppose that of 20 deaths that occur among male workers in this age group who have worked for at least 1 year in a chemical plant, 5 are due to lung cancer...

help scott biostatis
The proportion of deaths due to lung cancer in males ages 15-64 in England and Wales during the period 1970-1972 was 12%. Suppose that of 20 deaths that occur among male workers in this age group who have worked for at least 1 year in a chemical plant, 5 are due to lung cancer...

Help scott biostats
The value of mammography as a screening test for breast cancer has been controversial, particularly among young women. A study was recently performed looking at the rate of false positives for repeated screening mammograms among approximately 10,000 women who were members of ...

biostats
complete this: We estimate the probability by Pr( X ? 8) years where X is normally distributed with mean 5.24 and sd = 1.90. Assuming normal distribution we want prob that x >=8 P(x>=8) = P(Z >= (8 - 5.24)/1.90) = P(Z >= 1.45) = 1 - P(Z<1.45) =

biostats
what is the probability by Pr( X ? 8) years where X is normally distributed with mean 5.24 and sd = 1.90? HELP!!! thank you!

biostats
what 4 values do i need to enter into a box plot graph calculator? median and what else Thanks

biostat
based on the data below for a 25 day hospital stay: medical service provided 9 mean of medical services provided 11.11 standard deviation 8.29 surgical services provided 16 mean of surgical services provided 7.19 standard deviation 3.1 is there any difference in duration of ...

biostat
based on the data below for a 25 day hospital stay: males staying in hospital 11 mean of males staying in hospital 8.72 standard deviation 7.91 females staying in hospital 14 mean 8.5 standard deviation 3.48 is the duration of hospital stay affected by gender? which gender had...

biostat
based on the data below for a 25 day hospital stay: 1)patients who received antibiotics 7 mean of patients who received antibiotics 11.57 standard deviation 8.81 patients who did not receive antibiotics 18 mean 7.44 standard deviation 3.7 is the duration of hospital days ...

biostats
sorry...it should say x, s, n x=mean s=standard deviation n=number of patients

biostats
Suppose we divide the patients according to whether or not they received antibiotics, and calculate the mean and standard deviation for each of the two subsamples: answers: x, s, n x sd n Antibiotics 11.57, 8.81, 7 No antibiotics 7.44, 3.70, 18 interpretation: It appears that ...

biostats
If a have calculated 2 standard deviations from a sample of for example 25 day duration in a hospital for 2 groups ( 1 group was given antibiotics , the other group was not given the antibiotics) The standard deviation for group given antibiotic was 8.23 and the standard ...

statistics check my work..thank you
Use “service” to assess if there is any difference in duration of hospital stay based on what type of service medical or surgical the patient received during the 25 days in hospital (Key medical=1, surgical=2) what is the sample size, mean and standard deviation? ...

statistics check my work
Use gender to assess if there is any difference in duration of hospital stay based on gender. what is the sample size, mean, standard deviation of the males and females during the 25 days in the hospital (key 1=male, 2= female) Duration ........Gender 5............. 2 10...

math
In most geometry courses, we learn that there's no such thing as "SSA Congruence" . That is, if we have triangles ABC and DEF such that AB = DE, BC = EF, and angle A = angle D, then we cannot deduce that ABC and DEF are congruent. However, there are a few special...

maths
find the equation of the tangent to the curve 3xy^2 -4+2y=29 at the point (1,3)using implicit differentiation.

chemistry
a weather balloon is filled with helium to a volume of 250 l at sea level, where pressure is 760 mm hg. assuming constant temperature, what will be the volume when the balloon raises to a height of 25 km, where the pressure is only 10 mm hg

Verbal reasoning
How old is May,if Mary is two years older ,and Robert ,who is a year younger than Mary,will be ten next week?

Verbal reasoning
Ann

Verbal reasoning
If Tom is taller than Mary ,and Mary is taller than Ann ,who was the shortest ?

math
suppose that $2550 is invested in a saving account with a rate of 8.25%. how much interest will be received in 8 years?

Chemistry
Thank you so much DrBob222. I really appreciate your help!

Chemistry
So this is a three part question. I solved the first part correctly but I need help with the second and third. Q: The dissociation equilibrium constants for the protonated form of of alanine (a diprotic amino acid, H2X+)are Ka1 = 4.6 x 10^-3 and Ka2 = 2.0 x 10^-10. Assume that...

Geometry
2x+y=50 x+1/2y+(a^2+b^2=c^2) x=15

Geometry
Given: ?ABC, AB = BC Perimeter of ?ABC = 50 Perimeter of ?ABD = 40 Find: BD BD is the altitude and I got 15, 15+20+5=40 20+20+10=50

Geometry
oh yeah....

Geometry
Two poles of lengths 10 ft. and 15 ft. are set up vertically with their bases on horizontal ground 12 ft apart. Find the distance between the tops of the poles. I got 7.53 ft is this right, if not can you explain and post solution

Reasoning
Deborah's father is twice as old she is now.if their ages add up to 45 years how old is Deborah.

Social Studies
Ooo I get it now thanks you for your help ,the correct answer is C

Social Studies
I think that because each time Maria pays off the debt in full sooner than expected.

Social Studies
Maria ivanov has owned a successful clothing boutique chain for 20 years. Sha has gone into debt several times to expand her business.each time she paid off the debt in full sooner than expected. How will Maria's record affect the loans she is offered? She will be offered ...

Social Studies
In which h economic situation would interest rate decrease? Most people are saving rather than buying houses••• Average families are choosing to invest in new businesses High consumption is driving a surge in the services sector Increased job stability is ...

Geometry
In rhombus MPKN with an obtuse angle K the diagonals intersect each other at point E. The measure of one of the angles of a ?PKE is equal 16°. Find the measures of all angles of ?PKE and ?PMN.

Geometry
The distance from the center of a square to its side is 4 yd. Find the perimeter of the square. if you post the answer it would be a big help

Basic Numeracy and statistics (math)
A rocket is shot into the air with an initial velocity of 800m/sec. The equation h = -16t2+144t models the height of the ball. how long does it take for the rocket to hit the ground (h=0)?

physics 1
A floating cube is 10 cm on a side and has a density of 800 kg/m^3 . IT is floating in fresh water that has a density of 1000 kg/m^3. what percent of the cube is above the surface of the water? Again, my professor says it is 20%, but how??

physics 1
Glass has a density of about 2500 Kg/m^3. fresh water has a density of 1000 kg/m^3. if a 5 kg block of glass is sitting on the bottom of a freshwater fish tank, what is the normal force on the floor of the tank? 30N is what my professor says is correct, but im confused how?

Geometry
How much more pizza is in a 12-in. diameter pizza than an 8-in. diameter pizza? Round your answer to the nearest hundredth. Be sure to show all work and label your answer!

Chemistry
How many grams of lithium are required to completely react with 61.9 mL of N2 gas at STP

Business
You are shown a coin that its owner says is fair in the sense that it will produce the same number of heads and tails when flipped a very large number of times.

Geometry
On the scale drawing of a floor, plan A room is 7 in. long on the scale drawing. Find the actual length of the room.

Physical science
Calculate the mass of carbon monoxide that was needed to produce 78 grams of methanol by the following reaction: 2H2+CO=CH3OH

Physical science
Determine the number of moles of sodium hydroxide produced when 2 moles of sodium and 3 moles of water react to form sodium hydroxide and hydrogen gas.

physics
c

biochemistry
What is the concentration of H+ in a solution of 0.2 M NaOH? i got [H+] = 5x10^-14, is this correct? all i did was [H+][OH-] = Kw

calculus
The region bounded by the given curves is rotated about the specified axis. Find the volume V of the resulting solid by any method. y = ?x2 + 7x ? 12, y = 0; about the x-axis

calculus
Use the method of cylindrical shells to find the volume V generated by rotating the region bounded by the given curves about the specified axis. y = 4x ? x2, y = 3; about x = 1

Algebra
Factor: 2x^2 +13x-6 Please give step by step directions. I have tried doing it, but I can't get the right numbers. Thanks!

Physics
A 23.7 kg child, with a 4.35 kg backpack on his back, first stands on a sidewalk and then jumps up into the air. Find the net force (positive up/negative down) on Earth due to the child when the child is (c) standing still and (d) in the air.

math
L=5feet,w=5feet

physics
I think that the answer is 1.8 3.6/2(for the time it toke to go up then back down)=1.8 I am only in 7th grade so i am just guessing hope this is the right answer though :)

math
thank you Reiny

math
A rope goes from one building to another. The distance between the buildings is 10m, and the rope is tied at each building at a point 8m and 4m from the ground. Find the length of the rope.

Effective Learning Environment
is this a real classroom?

Effective Learning Environment
i would pick either c or d

Math
i was just trying to help :( and i also did not guess and apparently got the right answer i found the area of the cycle then the cylinder

Math
i think that the area is 213.63

math
didn't i get the right answer

math
List the sides of triangle ?MNP in ascending order (shortest to longest) if: m?M = 64°, m?N = 48°, for this one i am not sure if your supposed to find the third angle and or the third side can you guys explain and show me the answer i got 132 degrees but can't find...

math
In an isosceles triangle, the perimeter is 75 cm and one of the sides is 25 cm. Find all its sides. Can you find all angles of the triangle? Explain your answer.

Trig/PreCalc
Find the interior angles of the triangle with vertices (-4,1), (1,-6), and (5,-1)

math
if 5 people want to share a 2 pound sack of potato chips equally by weight, how many pounds of potato chips should each person get?

Math
A ball is dropped from a height of 16 feet and always rebounds 0.25 of the distance fallen.How high did it rebound the 5th time?

Chemistry
Hi, How do you know how many ligands a metal ion needs to form a complex ion? So for example, with (Fe(H20)6)2+, how am I supposed to know that the Fe needs 6 H20's, rather than 4? Thank you!

math
what will it be??

math
determine which ordered pair is not a solution of y = -5x -4 (10, -52) (7,-39) (-7, 31) (8,-44)

math
thanks i will

math
i dont really get it :/

math
What is the monomial if a cube of a monomial is:1/8 a^27

math
4/9 b^6 writes as a square of a monomial is it (4/9 b^6)/2

Algebra
kx^2-3k+5=0 find the solutions (roots)

Math
My sister is 8 years older than I am. The sum of our ages is 26. Find our ages

geometry
thanks :) :D

geometry
Prove that the angle bisectors of the base of the isosceles angles of the isosceles triangle are congruent using statement and reason proof i dont really now how to prove this problem but i now what a transversal is and the angles of a trashes line. can u guys plz solve and ...

math
thank you !!!!!!!!!!! :)

math
find the image of S(-1,-3) after a reflection scross the line y=-2

Office finances
6. What must a depositor add to a check before the bank will accept it for deposit? A. Cancel B. Void C. Endorsement D. Date of deposit

chemistry
Pl help...what are the isomers of chlorodibromobenzene

chemistry
what are the isomers of chlorodibromobenzene

Chemistry
What are the isomers of chlorobromobenzene

Physics
If you reduce the distance between two point charges to one third of the original distance, the electromagnetic force changes by a factor of:

accounting
provided accounting services to dress shop $8,500. payment to received on july 9th how would this journal entry be posted to the general journal.

Accounting
Rented an office and paid three months rent in advance to property Management check #001 $4,500. How would this journal entry be posted to the general journal.

accounting
Invested $19,000cash in the business along with $6,000 of office equipment. How would this journal entry be posted to the general journal.

intermediate algebra
a cyclist bikes at a constant speed for 19 mile. He then returns home at the same speed but takes a different route. His return trip takes one hour longer and is 24 miles. Find his speed

Math HELP HELP
Express the following in completed square form. x^2+4x-41

social studies
how did the siege at the Alamo influence the response of the Texas settlers? it force them to recruit native Americans it forced them to surrender it strengthened their resolve to fight*** it prompted them to have public forums

precalculos
The cost C of producing x thousand calculators is given by the following equation. C=-15.2x^2+15,990x+580,000(x??175) Find the average cost per calculator for each of the following production levels. 40,000?; 60,000? and 175,000

Chem
A gas is used to fill a container up, there are 17.8 moles. What will be the new volume of the gas in the container at STP? (I don't understand which gas law to use)

Biology
Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5: GCCAAGGCACTACGCTACGTCGCATTATAC ...

Math
Suzanne bought 50 apples at the apple orchard. She bought 4 times as many red apples as green apples. How many more red apples than green apples did Suzanne buy?

El Paso Community College
What are the joules needed to melt 50.0g of ice at 0 degree C and to warm the liquid to 65.0 degree C?

  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. 14
  16. 15
  17. Next>>