Posts by Stephanie

Total # Posts: 1,243

English
fill in the blank Which one of these careers ____ to six-figure salary? a. lead b. are leading c. leads d. have led c <--

BIO 12
BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A and T, Position #2 ...

Need HELP really bad test tommorrow
x is the values you plug into like 0,1,2,3 but I'm confused how to solve when plugging in because of the greatest integer function value

Need HELP reall bad test tommorrow
how to make a xy table for the following greatest integer equation. f(x)=2[x], g(x)=[2x], f(x)=-[[x]], and g(x)=[[-x]] thank you for the help

science
2.5

math
You have to draw three circles that go from up to down, then draw circles across so it goes left to right until you have nine in each row. Or you can have three circles going left to right then draw circles from up the down until you have nine in each column.

Math
*(and/or width) of a square...

Math
I think that since you need to know the length (and width) of a square (and pretty much any other shape) to find out its area, that's how they are related. Or you could always work backwards, knowing the area but not the side lengths. Hope this helps! Sorry if it didn'...

Math
$9118 + $609 = $9727, then $9727 - $1011 = $8716, then $8716 + $705 = $9421. Finally, you have to do $9421 - $9118, which equals $303. So, she had $303 more by the end of May from how much she had by the start of March. Hope this helped :)

Math
Correct!

Finance
Suppose the firm (has sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent) had 85,000 shares of common stock outstanding. What is the earnings per share, or EPS, figure? What is the dividends per ...

Finance
Suppose the firm in paid out (sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent) $73,000 in cash dividends. What is the addition to retained earnings?

Finance
Building an Income Statement Papa Roach Exterminators, Inc., has sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent. What is the net income for this firm?

algebra
your test scores in one class are 80 and 88. what possible scores can you earn on your next test to have a test average between 84 and 89, inclusive?

Algebra 2
a car travels for 2 hours at r mph and then decreases its speed by 5mph for the next 3 hours. What is total time traveled?

English
Samuel Johnson's Letter to Lord Chesterfield ? Help? Where in the letter does the tone seem ironic? And also where does the tone shift? Please Help

alGEBRA 1
20 ib + 2%

Pre-Calculus
How do I solve these equations? I need to create an equation given the characteristics? I have to be able to graph a parabola but first I need help solving this. 1.Focus (1.5,1); opens right; directrix x=0.5 2.Focus (1,4);opens down; contains (-3,1)

English
1.If para- means beyond, then a paradox is something that is... 2.Examples of dogma 3.Using literal translations without the dictionary. -The prefix ortho- means "straight" or "correct" -The prefix hetero means "different" -The prefix homo means &...

Algebra
Explain how the graph of f(x) = ln x can be used to obtain the graph of g(x) = e^(x-2).

Algebra
Explain why an even function does not have an inverse that is a function.

Math (Finite)
In how many ways can a committee of 7 people be chosen from 15 married couples if 2 couples must be on the committee?

Math (Finite)
A test for a certain drug produces a false negative 5% of the time and a false positive 8% of the time. Suppose 12% of the employees at a certain company use the drug. If an employee at the company tests positive, what is the probability that he or she does not use the drug?

Math (Finite)
An election between two candidates is held in two districts. The first district, which has 60% of the voters, votes 40% for candidate 1 and 60% for candidate 2. The second district, with 40% of the voters, votes 60% for candidate 1 and 40% for candidate 2. Who wins?

Math (Finite)
Find the probability that among five persons, at least two were born on the same weekday.

Math (Finite)
A calling card offers two methods of paying for a phone call. Method A charges $0.02 per minute but has a $0.6 connection fee. Method B charges $0.045 per minute but has no connection fee. Write the equations that show the total cost, y, of a call of x minutes for methods A ...

Math (Finite)
5. Let A = 1 4 2 3 and B = 3 -2 4 6 calculate the entry in the second row, second column in AB

Finite Math
11. As part of a weight reduction program, a man designs a monthly exercise program consisting of bicycling, jogging, and swimming. He would like to exercise at most 38 hours, devote at most 3 hours to swimming, and jog for no more than the total number of hours bicycling and ...

Finite Math
15 An appliance store sells two brands of televisions. Each Daybrite set sells for $425, and each Noglare set sells for $700. The store’s warehouse capacity for television sets is $400, and new sets are delivered only each month. Records show that customers will buy at ...

Corporate Finance
Building an Income Statement Papa Roach Exterminators, Inc., has sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent. What is the net income for this firm?

Math (Finite)
A town council has 11 members, 6 Democrats and 5 Republicans. If a 3‐person committee is selected at random, what is the probability that Republicans make up the majority?

Finite Math
A town council has 11 members, 6 Democrats and 5 Republicans. If a 3‐person committee is selected at random, what is the probability that Republicans make up the majority?

Math (Finite)
If a 3]person committee is selected at random, what is the probability that Republicans make up the majority?

Mathematics
Two cars drive from town A to town B at constant speeds. The blue car travels 25 miles per hour and the red car travels 60 miles per hour. The blue car leaves at 9:30 am and the red car leaves at noon. The distance between the two towns is 150 miles. Who will get there first? ...

Problem Solving
Thanks! I thought so but that just seemed so simple too me. I thought there was a catch to it.

Problem Solving
Liz has 2 books of 100 stamps with 6 left over. Chelsea has 3 books of 100 stamps with 8 left over. If they put all their stamps together, how many stamps will they have?

Language Arts 6th grade
Oh and this is ActII

Language Arts 6th grade
This is from Phantom Toll Both. I am having trouble finding similarity and differences can you give me a hint of start me off that would be great. At least two ways which Tock and Humbug are alike and different

Chemistry
What volume of 1.45 H2SO4 is required to neutralize .050L of .75M KOH?

Lanuage Arts
Question For the last question of Lesson 6: Third Read: The Phantom Tollbooth, Act I Connections Education Language Arts 6 B Unit 3: Adventures and Imagination I do not understand which book to use for the answer. Plz can you help me I have tempory zero :/

Biochem
Describe the relationships among the major components that maintain Ca homeostasis. (Identify all the major factors which are involved in Ca homeostasis).

Science
Can you give me help understanding this question? A skydiver prepares to jump out of a plane. Explain how gravity and air resistance will affect the motion of the skydiver before and after he or she opens the parachute.

Science
Can you check my work PLzzzzz got alot of science for today.

Science
Can you plz check asp 1. Suppose the total momentum of two masses before a collision is 100 kg m/s. What is the total momentum of the two masses after they collide? (1 point) 0 kg m/s 50 kg m/s 100 kg m/s 200 kg m/s 2. What is the momentum of a 20.0 kg scooter traveling at 5....

Math
It is 1/7

Science
Thanks alot Got my grade up too :)

Science
Plz check it fast or just improve advice 9. Provide three statements that demonstrate the importance of units when describing motion. (3 points) Three statements that demonstrate the importance of units when describing motion are 1.unit i m/s indicate it is in SI unit 2.It ...

Science 6 th grade
Can you plz check this :0 True/False 1. Kilometers per hour describes the speed of an object. (1 point) true false * Multiple Choice 2. Which of the following reference points would allow you to observe the speed of a car that you are traveling in? (1 point) an airplane flying...

math
5.8 + 5.758

math
If i had a pizza, and i ate4/8 of the pizza and my sister ate 3/8 of the pizza, how much pizza did we eat

math
If

College algebra
8.8x10^3 hours in a year approximate how many in one year

SS 6th grade
Thank you some of them helped

SS 6th grade
Its about Roman empire and the fall of the Romans so basically all roman.

SS 6th grade
I have to study for a test which is called New Empires and New Faiths Unit Test. Do you have any websites that I could go to review or to practice?

physics
A 42.5 g marble is fired vertically upward using a spring gun. The spring must be compressed 7.0 cm if the marble is to reach a target 27.0 m above the gun. What is the change in gravitational energy of the marble during its ascent?

math
If you have a bag of alphabet tiles that contains one tile for each letter of the alphabet. What is the probability that you will pull a vowel?

Math
are you sure sureeee

Math
write the quotient of -4 and a number, which is then increased by the product of -13 and the number?

algebra
solve using ac method 10a^2-27ab+5b^2

help! Physics
I've been getting this question wrong so many times! What is the relationship between the coefficient of friction and the time that it takes the object to reach the bottom of the ramp?

math
the flour power bakery makes 200 cherry cheesecakes at a cost of $2.55 each. if a spoilage rate of 3% is anticipated, at what price should the cakes be sold to achieve a 35% markup based on cost?

algebra
if 240 widgets cost $36, what is the cost of 180 widgets?

algebra
the midpoint of a line segment is (3,4). one of the endpoints of that line segment is (7,4). what is the other endpoint?

algebra
if a school has 24 teachers and 480 students, what is the ratio of teachers to students?

Algebra
Niko had his savings increased by 5% this year. He started with $350 in his account and calculated how much he had at the end of the year by using the following sets of calculations: $350×0.05=$17.50 $350+$17.50=$367.50 Find a single number that Niko could have ...

Math
What does it mean by fine a binomial expression for n in general terms of a?

Math
Suppose you find the ratio of the lengths of adjacent sides in a parallelogram. This ratio is equivalent to the ratio of the adjacent sides in another parallelogram. Are the figures similar? Explain.

Social studies
It's C. It says so on page 178 in the text book

Math
If someone could help me with these that would be great! :) Directions: Solve the equations. 1.) tan4x=1 Location on Unit Circle: Period: General Solution: 2.) sec xcsc x=2 csc x Location on Unit Circle: Period: General Solution:

Math
Hi! Can someone help me with these? I just learned about them yesterday but I'm really confused. All my teacher wants me to do is solve each equation and that's all the directions she gave. Thanks so much! 1.) 3cot^2 x-1=0 Location on Unit Circle: Period: General ...

math
is not b

math
Describe the vertical asymptote(s) and hole(s) for the graph of .y=(x-3)(x-1)/(x-1)(x-5) A. asymptote: x = 5 and hole: x = 1 B. asymptote: x = –5 and hole: x = –1 C. asymptote: x = –3 and hole: x = 5 D. asymptote: x = 5 and hole: x = –1

math
i know its not b

math
Designer Dolls, Inc. found that the number N of dolls sold varies directly with their advertising budget A and inversely with the price P of each doll. The company sold 5200 dolls when $26,000 was spent on advertising and the price of a doll was set at $30. Determine the ...

english 4
its not b then.

english 4
What tells you that the speaker is using stream of consciousness in the passage from Pedro Paramos? A. the speaker’s recollection about sleeping with her mother B. the uncertainty about the speaker’s actual situation C. the speaker’s concern that she didn’t...

english 4
Why does the speaker of Childe Harold's Pilgrimage admire the ocean? A. The ocean is beautiful and its sounds are soothing. B. Many people depend on fish from the ocean for food. C. The ocean is unchanged by human activities. D. The ocean provides a way to travel to ...

english 4
In what way does third section of “In Memory of W. B. Yeats” reflect the tension of the decade in which it was written? A. The poem describes writers with strong political beliefs. B. The section describes the era in which a famous poet died. C. The section describes...

english 4
Which phrase from “The Rime of the Ancient Mariner” contains alliteration? A. “The western wave was …” B. “Had I from old …” C. “And some in dreams …” D. “A spring of love gushed …”

english 4
it between b and d

english 4
Which word best summarizes Brooke's tone in “The Soldier”? A. guarded B. determined C. uncertain D. idealistic

english 4
a.

english 4
How is human joy different from the skylark's joy in “To a Skylark”? A. Human joy is not heard by others. B. A skylark has joy only when flying. C. A skylark's joy is based on unlimited freedom. D. Human joy is always touched by sorrow.

6TH GRADE MATH
Ms. Sue did I have the right concept down? I would have the same correct answer as you did.

6TH GRADE MATH
Write an equation you can use to find the length of the rectangle. area=72 m^2. 8m=length xm=width My equation is 8x=72 Am I correct?

english 4
I'm not sure if its c or d

english 4
Critical Reading Identify the letter of the choice that best completes the statement or answers the question.The excerpt from Midsummer, XXIII, primarily concerns A. race riots in England. B. the failure of Shakespeare’s drama in modern times. C. the passing of seasons in...

english 4
In “The Rocking-Horse Winner,” what does Paul keep hearing the house whisper? A. “Your mother does not love you!” B. “There must be more money!” C. “You must leave while you can!” D. “Your luck will change!”

us history
which of the following describes the main reason the Spanish conquistadors needed native american slaves? A: they needed help to find gold and send it back to Spain B: the native american slaves aided them with their tobacco crops C: the Spanish wanted to convert the native ...

Spanish 3
Hello! I need someone to check over my Spanish answers and see if I have them right. And if I don't, can someone please help me? Thanks a bunch! :) Directions: Re-write using Direct and Indirect Object Pronouns when needed. 1.) I read the book to Helena. My answer: Le&...

Math
Mike started a savings account by depositing $9. Each month, he deposits more money than the month before. At the end of 41 months, he has saved $9,389.00. How much more does he deposit each month?

english 4
What is shown on the tomb described by the speaker in “An Arundel Tomb

math
Which ratio compares 15m to 45cm?

fuctions and statistics
one foot is equivalent to approximately 0.3048 meters. if a building is 65-feet long, what is the length of the building in meters, to the nearest tenth?

Physics
A sign that weighs 670N is mounted at the end of a 2.00-m long rod of negligible weight. The supporting cable is connected at angle theta=30deg to the center of the rod. What is a) the tension T in the supporting cable, and b) the horizontal and vertical components of the ...

Chem please help
the answer should be B

math
At breakfast Gino drank 2/3 of the orange juice in a container. He drank 15 ounces of orange juice. Write a multiplication equation that you can use to find out the amount of orange juice that was in the container before Gino had breakfast?

science
if the pitcher moved his arm 1.1 m while accelerating the ball, how much work did the pitcher do on the bat

English
What is shown on the tomb described by the speaker in “An Arundel Tomb

  1. Pages:
  2. <<Prev
  3. 1
  4. 2
  5. 3
  6. 4
  7. 5
  8. 6
  9. 7
  10. 8
  11. 9
  12. 10
  13. 11
  14. 12
  15. 13
  16. Next>>