Posts by STEPHANIE

Total # Posts: 1,218

Science
Field mouse

Science
A mouse that eats grass is called a ......

Physics
Brownian motion

Algebra
Suppose you want to draw a rectangle where the width is 7 inches less than the length and the diagonal is 7 inches longer than the length. What are the dimensions of the rectangle?

reliabiility
According to classical test theory, if the observed variance of a test is 50 and the true variance is 40, what is the estimated reliability of the test

Math
If rCosx=3 and rSinx=4, find the value of r and x.

Literature
Discuss the significance of the "Ale house" in Oliver Goldsmith's "She stoops to conquer"

Physics
For reference, I get -0.0406 for Mu_k. Which, y'know, shouldn't be negative, probably. At least considering that acceleration is to the right and therefore friction should be to the left (on the FBD).

Physics
A box (mass=34kg) is set on an incline (angle=36.5 degrees), attached to a string. The box is let go slowly with a tension of 205N on the string, and starts sliding down with an acceleration of 0.12m/s^2. What was the coefficient of kinetic friction between the box and the ...

statistics
Would I set it up like this? -1.5 = x-50/5???

statistics
On a entrance exam, the mean was 50 and standard deviation was 5. If Ricky's z-score was -1.5, what was his exam score? I don't have a clue how to start to answer this question...

maths
Why is the open ended frequency distribution necessary

Math
Kay wants to know the length of large pond on property. One stake is at 50m with an angle of 21 degrees. The 65m from the other end of the lake and the angle is 26 degrees. How long is pond?

Science
What net force is required to accelerate a roller coaster car that has a mass of 300 kg at Disney world at a rate of 8 m/s2 ?

Calculus
A car moves along a straight road in such a way that its velocity (in feet per second) at any time t (in seconds) is given by v(t) = 3t * sqrt(49-t^2)

Math
Using the letters A and B, the following two-letter code words can be formed: AA, AB, BB,Ba. Using the letters A, B, and C, how many different three-letter code words can be formed? I know that the answer is 27 from the answer sheet, but how? Can you please list the ...

Math
I don't want to spoil it... But it's 87. 8+7=15 :P

Math
Kate uses a copy machine to enlarge her rectangular design that is 6 inches wide and 8 inches long. The new width is 10 inches long. What is the new length. I got some weird number like 13.333. I multiplied 8 times 10 and divided 80 by 6.

Math
Find the number of foul shots Ryan made if he made 60% of the total shots he took I am not sure how to set up the problem

english 9
whats the answer to it tho? bc that's not helpful

Calculus
Can you please help me find the x and y intercepts of this equation. How do I solve this? y= x^2 √9-x^2

Calculus
I need help determining whether the following functions are even, odd, or neither. Please help me. 1. f(x)=4x+5 2. f(x)=x^3-x-2 3. f(x)=x^4-x / x^5-x 4. f(x)= x^3-x / x^5

US Government
Where in the Constitution does it give states equal representation in the Senate and also where is it stated or implied that it established states as vital components of the machinery of government? Please help.

Algebra
i don't know the answere but can someone tell me

Calculus
Write the equations of the circle in general form. 1. Points on circle (0,0), (0,8), (6,0) 2. Points on circle (1, -1), (2, -2), (0,-2). I don't know how to solve this given the fact that I don't know what the center or the radius of the circle is.

physics
Could you explain to me why E points towards the origin? The vector r points in the negative direction anyway (away from origin). so -j

physics
We have a charge q = -0.6 x 10^-6 C at origin. And a vector r = (0 m, -5 m, 0 m). Find the electric field E(r) as a vector expressed in terms of i j and k. Ok so far I got E(r) = k (0.6e-6)/(5)^2 = 216 N/C. But this is not a vector, how do I express this in terms of I j and K?

Calculus
Even after looking up how to do this and reading about it I still don't know how to find the slope of curve or the deritives . Please help solve these problems. 1. Y =x^3 p(-1, -1) 2. Y = x^4 /2 p(-1 , 1/2) 3. Y= 8x^4 -7x^2 +5x + 6 p(-1,2)

Government
If during the war, Congress has the power to declare war, what powers do the other branches of government have during the war?

English
I need help with writing a really good thesis statement regarding the stories Popular Mechanics by Raymond Carver and The Judgement of Solomon and their parenting styles. It's supposed to be compare and contrast but I'm stuck. Please help me.

Math
Please help me. You work every Sunday in the yard from 8:00 A.M. To 11:30 A.M. Draw a diagram that shows the rotation completed by the hour hand of a clock during this time. Find the measure of the angle generated by the hour hand in both degrees and radians. Compare this ...

Algebra
I don't know how to solve this at all. You work every Sunday in the yard from 8:00 A.M. To 11:30 A.M. Draw a diagram that shows the rotation completed by the hour hand of a clock during this time. Find the measure of the angle generated by the hour hand in both degrees and...

math
before swimming andrea walks for 12 minutes and burns 60 calories. While swimming she burns 10 calories per minute. Write a variable expression for how many calories Andrea burns while walking for 12 minutes and swimming for m minutes.

Math
If seven times a number is added to the squares of the number and the result is negative twelve, what are the numbers?

Ross
If seven times a number is added to the squares of the number and the result is negative twelve, what are the numbers?

Math
How many 3 5\8 board can be cut from a 10 ft board?

pre algebra
The difference between two numbers is 44. Five times the smaller is equal to 8 more than the larger. What are the numbers

Math
laura spent 20 percent of her money on a dress. she spent 2/5 of the remainder on a book. she had $72 left. how much money did she have at first?

Algebra
X/5 -g=a for x

math
Flying against the wind, an airplane travels 5600 km in 8 hours. Flying with the wind, the same plane travels 9900 km in 9 hours.

Global Communicaiton Studies
Which socio-cultural variable is the most important and why? Looking forward to your insights. Thank you!

Math- any help would be greatly appreciated
In triangle ABC, the medians AD,BE, and CF concur at the centroid G. (a) Prove that AD < (AB + AC)/2. (b) Let P=AB+AC+BC be the perimeter of triangle ABC. Prove that 3P/4 < AD + BE + CF < P.

Math
In triangle ABC, the medians AD,BE, and CF concur at the centroid G. (a) Prove that AD < (AB + AC)/2. (b) Let P=AB+AC+BC be the perimeter of triangle ABC. Prove that 3P/4 < AD + BE + CF < P.

precalculus
A drug is administered every 6 hours. The kidney eliminates 55% of the drug over that period. The initial dose is 210 mg. Repeated dosage is 70 mg. What is the "differnece equation"?

history
So aria what is the answer??? Was it successful and how did you determine it?

maths
power supply in Nigeria is assumed to be normally distributed with daily mean at 68 minutes and variance 49 minutes .what is the probability of having power supply for (1) less than 45 minutes? (2) at least 1 hour? (3) between 75 minutes and 90 minutes?

maths
using determinant method find the area of the quadrilateral ABCD given the coordinates A(3,3) B(-2,5) c(-1,2) D(1,1)

math
my son informed me that a comic book I purchased for 10 cents in 1948 is worth $85. today what has been the average annual compound rate of return on that valuable asset

physics
24.25

Math
In how many ways can 5 of 14 different sized and different colored beads be put on a string to form a necklace. would the answer be 14!/!9 ?

Energy of satellite PHYSICS
But how do I get it to Joules? thanks

Energy of satellite PHYSICS
An m = 43 kg mass instrument package is put into orbit at an altitude above the Earth of A = 23000 km. What is the kinetic energy of this satellite in Joules?

Biology
I'm sorry but I had to post this question again as I left out the question. In a certain species of plant, the allele to produce green melons (G) is dominant over the allele to produce yellow melons (g). A student performed a cross between a plant that produced green ...

Biology
In a certain species of plant, the allele to produce green melons (G) is dominant over the allele to produce yellow melons (g). A student performed a cross between a plant that produced green melons and a plant that produced yellow melons. When the student observed the next ...

math
The sum of the digits on a digital clock is 15. The number of minutes is 5 times the number of hours. Wheat time is it?

Pre-Calc
Negative square root of 22*

Pre-Calc
If tan theta equal - square root of 22 divided by 11 and pie/2 is less than theta and theta is less than pies, what is the cos of theta in simplified rationalized form

maths
One kilogram

Math
A cafe used 640 ounces of water to make tea how many quarts of water did the cafe USED

Infinite math
A company finds that producing 12 items costs $31, while producing 7 items costs $25. What's the company's marginal cost?

math
Home Depot wants to buy a new line of fertilizers. Manufacturer A offers a 19/14 chain discount. Manufacturer B offers a 24/12 chain discount. Both manufacturers have the same list price.

business math
Front Range Cabinet Distributors in Colorado Springs, Colorado, sells to its contractors with a 32% markup on cost. If the selling price for cabinets is $9,357, what is the cost to contractors based on cost?

AP Chemistry
Which of the following is true about lanthanides? A. they are all radioactive B. they are highly electropositive C. they are very common elements D. they have low melting and boiling points

MATH
HOW MANY CALORIES IS IN ONE BANANA?

math
In 2013, the price of a business math text rose to $120. This is 10% more than the 2012 price. What was the old selling price?

math
Satelite Corporation projects a year-end net income of $64,497. The net income represents 31% of its projected annual sales. What are Satelite's projected annual sales?

math
The factory wants you to build a box that will hold twice as many cubes. What are the dimensions f a box that contains two times as many cubes as a box that is 2 by 3 by 4

math
a major airline laid of 4000 pilots and flight attendants. if this was 12.5% reduction in the workforce, what was the size of the workforce after layoffs?

chemistry
what is the advantage of using the indirect method over the direct method for calculating the enthalpy change of 2KHCO3 - K2CO3 + CO2 + H20

Algebra
Over 350 students took a college calculus final exam. the scores of the students follow a normal distribution. using the information given below, determine the mean and the standard deviation for the students'scores. Give your answers to the nearest tenth of a percent. 1. ...

Chemistry
Ammonium carbonate decomposes upon heating according to the balanced equation: (NH4)2CO3(s) -> 2NH3(g)+CO2(g)+H2O(g) Calculate the total volume of gas produced at 27.0 degrees C and 2.03 atm from the reaction of 1.4kg of (NH4)2CO3. What is the pressure of each of the gases ...

math
I need to predict a certain number of pens in the bag how do i do this You have a bag of 100 pens you choose 7 green pens and 13 purple pens predict the number of purple pens in the bag.

AP Lang
If they give you a ruled paper, write the other way. What kindof figurative language is being used and what type of sentence is this

Math
If there are 10 more boys than girls,how many are girls and how many are boys? (I think out of 28)

math
First week sells 6 chairs for $80 each. Next week, if chair is not sold, it will sell for 0.85 times previous week's price. Store needs to sell 6 chairs for total of $270 to make a profit. what is the last week in which all 6 chairs could be sold so that the store makes a ...

Physics
Two particles approach each other with equal and opposite speed v. The mass of one particle is m, and the mass of the other particle is nm, where n is just a unitless number. Snapshots of the system before, during, and after the elastic collision are shown above. After the ...

physics
Suppose the horizontal sweep of an oscilloscope takes 80ms how many cycles of a 100 Hz wave will be shown?

English
edit: which one of these careers ______ to a six-figure salary? c <--

English
fill in the blank Which one of these careers ____ to six-figure salary? a. lead b. are leading c. leads d. have led c <--

BIO 12
BIO 12 DNA DOUBLE HELIX. Hi, I'm having troubles understanding the following question(s) and was wondering if anyone could give me a hand? Original DNA Double Helix: TACGGGATACCGCCGTTCACACGT ( Starting From Left; Position #1 would be between the first A and T, Position #2 ...

Need HELP really bad test tommorrow
x is the values you plug into like 0,1,2,3 but I'm confused how to solve when plugging in because of the greatest integer function value

Need HELP reall bad test tommorrow
how to make a xy table for the following greatest integer equation. f(x)=2[x], g(x)=[2x], f(x)=-[[x]], and g(x)=[[-x]] thank you for the help

science
2.5

math
You have to draw three circles that go from up to down, then draw circles across so it goes left to right until you have nine in each row. Or you can have three circles going left to right then draw circles from up the down until you have nine in each column.

Math
*(and/or width) of a square...

Math
I think that since you need to know the length (and width) of a square (and pretty much any other shape) to find out its area, that's how they are related. Or you could always work backwards, knowing the area but not the side lengths. Hope this helps! Sorry if it didn'...

Math
$9118 + $609 = $9727, then $9727 - $1011 = $8716, then $8716 + $705 = $9421. Finally, you have to do $9421 - $9118, which equals $303. So, she had $303 more by the end of May from how much she had by the start of March. Hope this helped :)

Math
Correct!

Finance
Suppose the firm (has sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent) had 85,000 shares of common stock outstanding. What is the earnings per share, or EPS, figure? What is the dividends per ...

Finance
Suppose the firm in paid out (sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent) $73,000 in cash dividends. What is the addition to retained earnings?

Finance
Building an Income Statement Papa Roach Exterminators, Inc., has sales of $586,000, costs of $247,000, depreciation expense of $43,000, interest expense of $32,000, and a tax rate of 35 percent. What is the net income for this firm?

algebra
your test scores in one class are 80 and 88. what possible scores can you earn on your next test to have a test average between 84 and 89, inclusive?

Algebra 2
a car travels for 2 hours at r mph and then decreases its speed by 5mph for the next 3 hours. What is total time traveled?

English
Samuel Johnson's Letter to Lord Chesterfield ? Help? Where in the letter does the tone seem ironic? And also where does the tone shift? Please Help

alGEBRA 1
20 ib + 2%

Pre-Calculus
How do I solve these equations? I need to create an equation given the characteristics? I have to be able to graph a parabola but first I need help solving this. 1.Focus (1.5,1); opens right; directrix x=0.5 2.Focus (1,4);opens down; contains (-3,1)

English
1.If para- means beyond, then a paradox is something that is... 2.Examples of dogma 3.Using literal translations without the dictionary. -The prefix ortho- means "straight" or "correct" -The prefix hetero means "different" -The prefix homo means &...

Algebra
Explain how the graph of f(x) = ln x can be used to obtain the graph of g(x) = e^(x-2).

Algebra
Explain why an even function does not have an inverse that is a function.

Math (Finite)
In how many ways can a committee of 7 people be chosen from 15 married couples if 2 couples must be on the committee?

  1. Pages:
  2. 1
  3. 2
  4. 3
  5. 4
  6. 5
  7. 6
  8. 7
  9. 8
  10. 9
  11. 10
  12. 11
  13. 12
  14. 13
  15. Next>>