Posts by Maria

Total # Posts: 2,062

chemistry
what are the isomers of chlorodibromobenzene

Chemistry
What are the isomers of chlorobromobenzene

Physics
If you reduce the distance between two point charges to one third of the original distance, the electromagnetic force changes by a factor of:

accounting
provided accounting services to dress shop $8,500. payment to received on july 9th how would this journal entry be posted to the general journal.

Accounting
Rented an office and paid three months rent in advance to property Management check #001 $4,500. How would this journal entry be posted to the general journal.

accounting
Invested $19,000cash in the business along with $6,000 of office equipment. How would this journal entry be posted to the general journal.

intermediate algebra
a cyclist bikes at a constant speed for 19 mile. He then returns home at the same speed but takes a different route. His return trip takes one hour longer and is 24 miles. Find his speed

Math HELP HELP
Express the following in completed square form. x^2+4x-41

social studies
how did the siege at the Alamo influence the response of the Texas settlers? it force them to recruit native Americans it forced them to surrender it strengthened their resolve to fight*** it prompted them to have public forums

precalculos
The cost C of producing x thousand calculators is given by the following equation. C=-15.2x^2+15,990x+580,000(x??175) Find the average cost per calculator for each of the following production levels. 40,000?; 60,000? and 175,000

Chem
A gas is used to fill a container up, there are 17.8 moles. What will be the new volume of the gas in the container at STP? (I don't understand which gas law to use)

Biology
Here are parts of the DNA base sequences for 7 organisms: Organism 1: GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2: GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3: GCTAAGCACTACGCTACGTCGCTTAATAGC Organism 4: GCTAAGGCACTACGCTACGTCGCATTATAC Organism 5: GCCAAGGCACTACGCTACGTCGCATTATAC ...

Math
Suzanne bought 50 apples at the apple orchard. She bought 4 times as many red apples as green apples. How many more red apples than green apples did Suzanne buy?

El Paso Community College
What are the joules needed to melt 50.0g of ice at 0 degree C and to warm the liquid to 65.0 degree C?

maths percentage
in a 400ml can of mixed juice, 41% is MAngo Juice, 3205% is pineapple juice and the rest is water. find the volume of Mango, pineapple and water ?

Chemistry
1.15gm

Chemistry
A chemist reacted 0.05 mol of sodium with water to form 50cm3 of sodium hydroxide what was the mass of sodium reacted Na+h2p-Noah+h2

Math
I walked 2/7 of a mile in 4/9 of an hour. at this rate, how far will I have traveled after an hour?

History Social studies
1. Which activity is part of both private and civic life? (1 point) learning about politics •• voting for a candidate going to sports games working at a bookshop 2. Why are elections necessary for good governance? (1 point) Elected officials can be fired at any time...

Math
A situation that could describe the ratio 52 to 12.

Social studies
Warsaw Pact United Nations<-- League of Nations British commonwealth North Atlantic treaty organization <--

Social studies
To which internatinal associations does the United States belong to?

History
Of the following choices which ones are considered democratic values? Select all that apply A. Serving in the military*** B. Honesty C. Patriotism D. Voting in an election ••

Algebra
Identify and interpret the decay factor for each of the following. a.) P= 400×(0.43)^t decay factor: 0.43 This means that the function decays by ___?___ % b.) f(t)= 3800×(0.84)^t decay factor: 0.84 This means that the function decays by ___?___ % c.) y= 21×(2...

English
No I don't know them.

English
The other questions didn't tell me the answers to these questions. Thank you for the suggestion though.

English
Need these answered soon please! 10.   The author of “My Brother’s Keeper” emphasizes Jamie’s conflict by describing the car accident in detail.*** detailing Jamie’s physical appearance and good grades. flashing back to earlier events with ...

Math precalculus
The revenue for a sale of x books at $80 each is given by R(x) = 80x. The commission for a revenue of x dollars is given by C(x) = 0.30x. Express the commission as a function of the number of books sold

American government
how does the president limit the legislative power of congress. a- by appointing congressional committee chairs b- by appropriating congressional spending c- by administering the law d- by using the veto

Georgia History
1. At which meeting was Georgia not represented? A.) Provincial Congress B.) First Continental Congress C.) Second Continental Congress D.) Council of Safety I think B Please help asap :)

math
write a program that takes an integer n and output the largest odd divisor of n

Chemistry
Dr. Bob222 I still didn't understand which is the reduction half reaction and its products and oxidation half reaction...and why is it O3 to IO3-...0 to -6 and then Please help...entrance exam soon Write the oxidation and reduction half reactions(showing e- lost or gained...

chemistry
Calculate energy change that produced the 4th line in lyman series

Chemistry
Please help...entrance exam soon Write the oxidation and reduction half reactions(showing e- lost or gained) for the foll O3 + I- -> IO3- + O2 (acidic)

Math
It's a riddle question. All six digits in the number even remember that zero is an even number one digit is use once and all the other digits is used twice is four times the hundreds digit 10 digit is the difference of the ones digit in the hundred digit is the same digit ...

Math
It's a riddle question. All six digits in the number even remember that zero is an even number one digit is use once and all the other digits is used twice is four times the hundreds digit 10 digit is the difference of the ones digit in the hundred digit is the same digit ...

Math HELP HELP
(a+4b,a-b) and (a-3b,a) find the length of the line segment joining this pair of points.

Math
(a+4b,a-b) and (a-3b,a) find the length of the line segment joining this pair of points.

Culturel Diversity
Talking the talk emphasizes the use of lableing individuals positivly

Chemistry
CHCl3 + MnO4- = Cl2 + CO2 + Mn+2 Balance the above with half reactions in acidic medium. For the above reaction, can you please show the half reactions...which is getting oxidised...both C and Cl's oxidation # are changing showing both getting oxidised,.how is this ...

CHEMISTRY
BALANCE THE REDOX REACTION USING HALF CELL METHOD IN AN ACIDIC MEDIUM CHCl3 + MnO4- = Cl2 + CO2 + Mn+2

Chemistry
Half reaction method of balancing redox reaction CHCl3 + MnO4- = Cl2 + CO2 + Mn+2

Math
24 dogs line up for breakfast. The first cat eats one fish, the second cat eats two fish, and so on, with each cat eating one more fish than the one before it. How many fish are eaten in total.

Math
it would be Sinea, because last year she spent 5 dollars on snacks and to get to 40 you have to multiply 5x8 which makes 40, so if Ren spent 10 dollars on snacks last year it would take 4 times that amount to get 40. then multiply the amount of the money they each spent on ...

Social studies
Type of American Indian dwelling in the Eastern Woodlands

English
Man-Made

chimistry
natriumsaltet

chimistry
hvorfor løsligheten av natriumsaltet til salsyre vann

chemistry
a) What is fellesioneffekten?   Veronal is a barbiturate (structure see above). Barbiturates is a substance class which occur in a variety of drug classes, including sleep medications (hypnotikasedativa), in painkillers (anesthetics) and anticonvulsants. A barbiturate is ...

chemistry
a) What is fellesioneffekten?   Veronal is a barbiturate (structure see above). Barbiturates is a substance class which occur in a variety of drug classes, including sleep medications (hypnotikasedativa), in painkillers (anesthetics) and anticonvulsants. A barbiturate is ...

chemistry
In quality control of raw materials for pharmaceutical production often used foul reactions to prove that raw materials in salt form containing the appropriate salt. Hydrochloride (eg. Amitriptyline hydrochloride) can be detected for example by precipitating the chloride ions...

chemistry
Cocaine is a weak base (Figure see below) with pKb = 5.59. Cocaine has local anesthetic effect (local anesthetic) but is also a narcotic.   a) Calculate the ratio of the concentration of cocaine and its conjugated acid in a solution which has. pH = 7.40 (that of blood) ...

chemistry
To create a 0.1 M carbonate buffer pH = 10.2. You choose to use a combination of HCO3- / CO32-. This buffer system has pKa = 9.9.   a) Calculate how much you need to weigh in each of the sodium salts, NaHCO3 and Na2CO3, to create 1.0 L carbonate (with total concentration ...

chemistry
a) Hva er fellesioneffekten? Veronal er et barbiturat (struktur se over). Barbiturater er en stoffklasse som forekommer i en rekke legemiddelgrupper, blant annet i sovemedisiner (hypnotikasedativa), i smertestillende (anestetika) og i antiepileptika. Et barbiturat er en svak ...

chemistry
Calculate the pH reaches 30.0 mL one 0.200 M solution of HCl salt of amitriptyline is added 100.0 mL of a NaOH solution of concentration 80 mM.

chemistry
Calculate the pH at 25 ° C when 120 mL of a HCl solution having a concentration of 50 mM is added 50.0 mL of a 120 mM ephedrine solution. Assume no change in temperature.   Amitriptyline is a drug used in treating depression. It is typically formulated as the ...

chemistry
presentation Tasks:  Ephedrine (structure see below) is a natural product that is used as a medicine in the treatment of asthma. The corresponding acid to ephedrine have pKa = 9.60 at 25 ° C.   Question:  Calculate the pH reaches 991 mg ephedrine ...

Maths
Ahmed says that there are 70 sweet in the box to the nearest 10 what is the least number of sweets that could be in the box

Maths
A plane setts off from airport A and flies due east for 100 km, then turns to fly due south for 80 km before landing at an airport b show that the approximate bearing of airport b from airport a is 129

History
Thanks!!

History
Which of these words best describes a merchant? A. Explorer B. Middleman C. Monarch D. Slave I have having trouble between Explorer and middleman... I think it is B.

biology
Color blindness is a defect in vision of colors, this defect is due to a localize-homologous segment of chromosome X. In the document I have a pedigree which the parents and their children are normal; but then most of the children got married to a diseased one which 50% ...

Math
In the cafetería,100 milk cartons were put out for breakfast at the end of breakfast 27 remained. What Is the ratio of the Number of milk cartons taken to the total Number of milk cartons?

Pre Calculus
Two forces with magnitudes of 150 and 75 pounds act on an object at angles of 30° and 150°, respectively. Find the direction and magnitude of the resultant force. Round to two decimal places in all intermediate steps and in your final answer. Having lots of trouble ...

Math
What do you do when you have for sale factor 0.5 and 0.25

Geometri euclid
The small circle and the large circle have the same center O. Chord AB is tangent to the smaller circle at C. Prove that the area between the large and small circle is the same as the area of the circle that has AB as a diameter

chemistry
Assuming all gases are at the same temperature and pressure, how many milliliters of hydrogen gas must react to give 41.0 mL of NH3? 3H2(g)+N2(g)→2NH3(g)

Chemistry
A typical antacid contains CaCO3. If such an antacid is added to 25.0 mL of a solution that is 0.250 M in HCl, how many grams of CO2 gas are produced?

Chemistry
A patient received 5.0 g of NaCl in 8 hours. How many milliliters of a 0.40 % (m/v) NaCl (saline) solution were delivered?

chemistry
Calculate the grams or milliliters of solute needed to prepare the following solutions. 1.)75. g of a 7.0 % (m/m) KCl solution 2.) 1250 mL of a 8.0 % (m/v) NH4Cl solution 3.) 270. mL of a 15.0 % (v/v) acetic acid solution I really just need to know how to work the first ...

chemistry
Solubility (g/100gH2O) Substance 20∘C 50∘C KCl 34.0 42.6 NaNO3 88.0 114.0 C12H22O11 (sugar) 203.9 260.4 Using the above table, determine whether each of the following solutions will be saturated or unsaturated at 50 ∘C. 1.) Adding 19.7 g KCl to 35.0 g H2O 2.)...

chemistry
What volume of 0.10 M NaOH can be prepared from 250. mL of 0.30 M NaOH? A) 0.075 L B) 0.25 L C) 0.75 L D) 0.083 L E) 750 L

chemisrty
Which one of the following compounds will NOT be soluble in water? A) NaOH B) Na2S C) K2SO4 D) LiNO3 E) PbO

Probability and statistic
Suppose the counts recorded by a Geiger counter follow a Poisson process with an average of two counts per minute. Round the answers to 3 decimal places. (a) What is the probability that there are no counts in a 30-second interval? (b) What is the probability that the first ...

college algebra
in a class of 30 students all of them are either female or smokers. while only 5 are female and smokers. if there are 12 male smokers in the class, then how many female nonsmokers are in the class?

Math
Wait, I figured it out, you do 36%.

Math
52%, 36%, or 12%??

Math
A survey showed that 36% of car owners prefer two door cars, 52% prefer four door cars, and 12% have no preference. You ask 300 people. How many do you think will prefer the two door cars.

Math
That would be 5.

Math
the probability of winning a game is 25%. how many times should you expect to win if you play 20 times.

Math
from a barrel of colored marbles, you randomly select 5 blue, 2 yellow, 3 red, 4 green, and 2 purple marbles. Find the experimental probability of randomly selecting a marble that is not yellow.

Chemistry
yup

science
Calculate the kinetic energy in joules of a body of mass 30kg at a velocity of 3ms-1

language arts
which sentence best describes the employer in the original story "the ninny" and the employer in the adaptation the governess

math
ms.sue is right

Science
How test tube babies are born?

Math
2.A. 6,501.5 * 1000 = 6,501, 500

English
Yes . She got on the bus to school every day. Its correct

Geography
I NEED help on the introduction

Geography
I need help with my introduction and topics for my five paragraph essay on why the stamp act was not fair.

life orientation
I don't have any idea how can i answer this question..can you please help me

English
thank you so much here if anything

life orientation
Right to have free movement

life orientation
3 human rights violation?

Calculus 1
Find the formula for a function of the form y=bxe^(-ax) with a local maximum at (4,12)...

algebra
a 38 inch piece of steels is cut into three pieces so that the second piece is twice as long as the first piece, and the third piece is three inches more than four times the length of the first piece. find the lengths of pieces.

Basic Finance
Suppose we observe the following rates: 1R2= 8%, 1R2= 10%. If the unbiased expectations theory of the term structure of interest rates holds, what is the 1-year interest rate expected one year from now, E(2r1)?

Math
A hockey team can win, lose, or tie a match. It gets 2 points for a win, 0 points for a loss, and 1 point for a tie. It has lost 10 out of the 28 matches it has played so far, and it has 30 points. Which two equations can be used to find its number of wins, w, and its number ...

chemistry
For the following reaction at equilibrium, which change would shift the position of equilibrium toward forming more products? (Circle your answer(s) as there may be more than one.) 2NOBr(g) 2NO(g) + Br2(g), ∆Hºrxn = +30 kJ/mol A) Decrease the total pressure by ...

algebra
A large swimming pool has a perimeter of 1,028 meters, this rectangular-shaped pool is 40 meters longer than 5 times its width. Find its dimensions. width m length m

  1. Pages:
  2. <<Prev
  3. 1
  4. 2
  5. 3
  6. 4
  7. 5
  8. 6
  9. 7
  10. 8
  11. 9
  12. 10
  13. 11
  14. 12
  15. 13
  16. 14
  17. 15
  18. Next>>