Posts by Jessica

Total # Posts: 3,397

music appreciation
Who was the first American-born conductor to lead the New York Philharmonic?

Calculas
area between the curves y=4-x^2 and y=x-8

Calculas
what is the velocity (in ft/s) of a sandbag 2.75 s after it is released from a hot-air balloon that is stationary in the air?

French
yes is correct

chemistry
If your car gets 21.4 mpg, how many L of CO2, will you release into the atmosphere, if you drove the 1280miles from Towson University to Key West Florida for a much needed break after taking Chemistry 121? Assume 1.05atm and 17.0C. What would your carbon load be in lbs (lbs of...

chemistry
Can someone please please help me thanks.

chemistry
226.38 x 1000 = 226380mL 226380mL x 0.7025 g/mL = 159031.95grams. I found those result is correct?

chemistry
The gallons I got 59.81 and the L octane 59.81*3.785= 226.38

chemistry
gallons octane to L octane will be #gallons x 3.785 liters right?

chemistry
Can you please do the all things for me please, I really need help. Thank you so much.

chemistry
How to solve for gallons needed?

Macroeconomic
Suppose the current interest rate is 12 percent and a bond with a face value of $500 that pays a coupon rate of 15 percent is selling for $450. Calculate the yield on this bond. How do I calculate the yield on this bond?

math
A 6pack of undershirtsome cost $13.98. This is $3.96 less than the cost of buyingas 6 individual shirts. If each undershirt costs the same amount, how much does each undershirt cost when purchased individually?

language arts
personification-personified is right!! BLANK ISN'T RIGHT

Organic Chemistry
Cu++ forms a blue-green complex with tetraphenylporphin in a 1:1 ratio. Say you have 100 mL of a 2.0 x 10^-4 solution of the Tetraphenylporphin. Exactly what weight of CuCl2 must be added to the solution to insure complete complexation without any excess cupric chloride ...

Child Development
1 - D 2 - B 3 - A 4 - D 5 - A 6 - C 7 - B 8 - D 9 - C 10 - A 11 - D 12 - C 13 - B 14 - A 15 - D 16 - D 17 - A 18 - A 19 - B 20 - A An educator demeaning a student on a public forum, in my opinion, is laughable in regards towards that person's label as a "professional...

Calculus
Here is some of the work so far that I have had helped with: A (3, 0, 0), B (3, 3, 1), C (0, 3, 1) the plane containing these points has normal vector n = <3 -3, 0 -3, 0 -1> x <3 -0, 3 -3, 1 -1> = <0, -3, -1> x <3, 0, 0> = <0, -3, 9> then curl F...

Calculus
A particle moves along line segments from the origin to the points (3, 0, 0), (3, 3, 1), (0, 3, 1), and back to the origin under the influence of the force field F(x, y, z) = z2i + 5xyj + 4y2k. I have tried multiple times to solve this problem but the answer is still not right.

PHI 208
He present specific factual examples that demonstrate harm to the environment

Algebra 2
mdks

language arts
1. B 2. A 3. B 4. C 4/4 100%

Calculas
Johnny is designing a rectangular poster to contain 15 in^2 of printing with a 5-in margin at the top and bottom and a 3-in margin at each side. What overall dimensions will minimize the amount of paper used?

Calculas
A box lid is to be made from a rectangular piece of cardboard measuring 72 cm by 216 cm. Two equal squares of side x are to be removed from one end, and two equal rectangles are to be removed from the other end so that the tabs can be folded to form a box with a lid. Find x ...

Calculas
an open box is to be made from a square piece of cardboard whose sides are 19 inches long,by cutting squares of equal size from the corners and bending up the sides. Determine the size of the aquare that is to be cut out so that the volume may be a maximum.

chemistry
A sample of oxygen gas occupies a volume of 3.84 L at 269. K. What volume will the sample occupy at 486. K?

chemistry
Sodium chloride has properties that are very similar to those of sodium. True or False

Health
1 drink!

Chemistry
In the following reaction, how many liters of carbon dioxide will be produced if 250 liters of oxygen is used in the combustion of sucrose given that both gases are at STP? C12H22O11 + 1202 -> 12CO2 + 11H2O I have had other ones in my homework that were very easy but this ...

Chemistry
When did these scientists make their contributions ? The years Democritus believes that the universe was made of tiny uncuttable particles. Heisenberg works with the Quantum Theory Chadwick finds the missing mass of the atoms nucleus Dalton's believes that atoms of a given...

Calculas
A man 6.5 ft tall approaches a street light 17.0ft above the ground at the rate of 8.00 ft/s. How fast is the end of the man's shadow moving when he is 5.0 ft from the base of the light? The end of the man's shadow is moving at a rate of_ft/s

calculas
A man 5.00 ft tall approaches a street light 17.0ft above the ground at the rate of 4.00 ft/s. How fast is the end of the man's shadow moving when he is 9.0 ft from the base of the light? The end of the man's shadow is moving at a rate of_ft/s

English
How would you describe someone who keeps blaming someone or something for something tragic and believes that person was responsible for that tragedy without no actual proof and that everybody else knows for a fact that the person is responsible?

Calculas
A 13ft ladder is placed against a verticle wall. Suppose the bottom of the ladder slides away from the wall at a constant rate of 2 feet per second. How fast is the top of the ladder sliding down the wall (negitive rate) when the bottom is 5ft from the wall? The ladder is ...

English
What character trait do you think this quote shows of the narrator in Annabel Lee? The angels, not half so happy in Heaven, Went envying her and me— Yes!—that was the reason (as all men know, In this kingdom by the sea)

Finance
3. Given the following information for Janicek Power Co., find the WACC. Assume the company’s tax rate is 35%. Debt: 8,500 7.2% coupon bonds outstanding, $1000 par value, 25 years to maturity, selling for 118% of par; the bonds make semiannual payments Common Stock: 225,...

Algebra
A woman wishes to invest $12,500 in three types of bonds: municipal bonds paying 8% interest per year, bank investment certificates paying 9%, and high-risk bonds paying 12%. For tax reasons she wants the amount invested in municipal bonds to be at least three times the amount...

Algebra
A confectioner sells two types of nut mixtures. The standard-mixture package contains 100 g of cashews and 200 g of peanuts and sells for $1.85. The deluxe-mixture package contains 150 g of cashews and 50 g of peanuts and sells for $2.45. The confectioner has 15 kg of cashews ...

Biology
Genome A 5-GCAGGCCATATAAAATAGCGCCATACTAGATACGGG CCATATTATTGCATATCCGCCGATTACAGGATTTAATTT GGGAATTCCCCGATTAACGCGATCGATCGGGCCATATC GATATGCATCGTAATCCGGTAGATTCACAGGTAG -3 Genome B 5-GCATACCCAAATTAATAACGGCGGTAGGCGACTCATT CTGATATACGCATCGGCATTTACCTACGGCCGGCCGGC ...

Chemistry
75.0 mL of a 1.40 M solution is diluted to a volume of 248 mL. A 124-mL portion of that solution is diluted using 165 mL of water. What is the final concentration?

Chemistry
68.0g of solute were dissolved in 393 mL of benzene. The solution froze at -0.50°C. The normal freezing point of benzene is 5.5°C and the molar freezing point constant is 5.12°C kg/mol. The density of benzene is .879 g/mol. Calculate the molar mass of the solute.

Chemistry
In a routine laboratory analysis, a solution of sodium chromate with a chromium concentration of 175.0 ppm is required. Calculate the molarity of this solution.

English
What is an example of morbidity in "The Fall Of the House of Usher" by Edgar Allan Poe ? I know what morbidity is but it's hard finding an example in the story so can you please help me find an example of it.

algebra
i appreciate this

algebra
16. Solve y = log3243. A. y = 0 C. y = 5 B. y = 3 D. y = 243 3. Which of the equations below describes the graph shown here? A. y = x – 2 C. y = –x + 2 B. y = x + 2 D. y = –x – 2 11. If the triangles in the following figure are proportional, what is the ...

Gen Chem
In an experiment I used .139 grams of an Alka Selzter table. A question asks us to determine the amount of CO2 dissolved in 5.10ml of 6M HCl. How do you go about solving such a problem?

9th grade math
The depth of water(d metres) in a harbour is given by the formula d = a+bsin(ct) where a, b and c are constants, and t is the time in hours after midnight. It is known that both b and c are non-zero and 20<c<35. If t=midnight, d=5; if t=noon, d=5; if t=1300, d=7; and if...

math
This is a 9th grade math problem by the way.

math
The depth of water(d metres) in a harbour is given by the formula d = a+bsin(ct) where a, b and c are constants, and t is the time in hours after midnight. It is known that both b and c are non-zero and 20<c<35. If t=midnight, d=5; if t=noon, d=5; if t=1300, d=7; and if...

English - Grammar
What tense is this verb ? The state police were pulling over many drivers? I think its past progressive but i don't know if it would also be considered past perfect progressive. what principle part is used to form the verb in each sentence? 1.The workers will have finished...

geometric progression
the 3rd term of a gpis 10 and the 6th term is 80 find the common ratio No2 if the 2nd term of a gp is 4 and the 5th term is 1over 16,the7th term is_

math
after 6 days,how many pounds of apples does the zoo use

math
38+7=45 /\ 38+2+5 40+5=45

Pre Albergra
Simplify. x5y4x3y6

Pre Albergra
The Pentagons ABCDE and PQRST are Similar: Find the length x of TP

English
What is the purpose of Annabel Lee by Edgar Allan Poe? What are some qualities and Character traits about of the Speaker in Annabel Lee? I need at least 5. so far I got romantic, dedicated, crazy, and obsessive .

English
What is moral lesson in Annabel Lee?

Calculus
The maker of an automobile advertises that it takes 11 seconds to accelerate from 15 kilometers per hour to 90 kilometers per hour. Assuming constant acceleration, compute the following. What is the distance the car travels during the 11 seconds (Round your answer to two ...

Introduction to Computer science
1. start 2. get item name, price, quality 3. set total value = price * quality 4. print total value, item name 5. stop

Chemistry (Equilibrium)
ooh, thank you!

Chemistry (Equilibrium)
Keq = (0.0855)^2/0.5-0.171 = 0.00731025/0.329 = 0.0222 Keq = 0.0222 is this correct?

chemistry
why do we use the limiting reactant data to calculate delta h? why might it be important to know delta h prior to running a reaction?

Equilibrium
I get 3.918... so does that mean I round up to 4.0? so the answer would be C?

Equilibrium
oh I realized, I have my 0.53M on 2SO2 and not 2SO3. Keq = (0.53-0.30)^2/(0.30)^2(0.15) = 0.26 Is this correct? :)

Equilibrium
2 SO2(g) + O2(g) <==> 2SO3(g) Initially, 1.6mol SO3 is placed in a 3.0L container. At equilibrium, [O2] = 0.15M. What is the value of Keq? A. 0.26 B. 1.2 C. 4.0 D. 43 My work: ...2SO2...+...O2...<==>...2SO3 I 0.53M.....-----.........----- C +0.15.....+0.15........-...

statistics
I have no idea how to solve this. In a sample of 16 students, 15 were right-handed. Can we construct a 95% confidence interval for the proportion of all students who are right-handed?

Chemistry (Equilibrium)
Thanks very much!

Chemistry (Equilibrium)
Consider the following equilibrium system at 900°C: H20(g) + CO(g) <==> H2(g) + CO2(g) Initially 5.0 moles of H2O and 4.0 moles of CO were reacted. At equilibrium, it is found that 2.0 moles of H2 are present. How many moles of H2O remain in the mixture? Would be ...

Math
Maria has 24ft of fence.she wants to make the lalgest rectangular area possible for her dog.what length should she make each side

Algebra 2
How do I solve this using the Quadratic formula and finding the determinant? 1. 5x-6=0 2. x+25=0

English
I know this sounds dumb, but what do you call people who are rich but they act normal, don't try to show off at all, and is very kind.

Calculus
BoxedNGone truck rentals calculates that its price function is p(x)=160-2x,where p is the price (in dollars) at which exactly x trucks will be rented per day. Find the number of trucks that BoxedNGone should rent and the price it should charge to maximize revenue. Also find ...

English (Grammar)
What part of speech is the infinitive phrase used? Is this a noun, adjective, or adverb? 1. The coach's example is one to take seriously. 2. We all made an effort to work harder. 3. The contest requires all entries to be mailed by Thursday. 4. The players were eager to try...

Math
You are measuring walnuts for banana walnut oatmeal and a spinach and walnut salad. You need 3/8 cup of walnuts for the oatmeal and 3/4 cup of walnuts for the salad. You have a 1/4-cup scoop. Describe two different ways to find how many scoops of walnuts you will need. PLEASE ...

Chemistry
A piece of copper of mass 21.3 g at 106.0 °C is placed in a vessel of negligible heat capacity but containing 53.0 g of water at 19.3 °C. Calculate the final temperature of the water. I keep getting 22 celsius and I'm not sure where I'm going wrong. I plug it ...

Math
Determine the exact radian measure for each angle. 40 degrees.

Calculus
Find all relative extrema. Use the Second Derivative Test where applicable. f(x)= cosx - x (0,2ð)

Chemistry
Calculate the enthalpy change for: C2H4(g) + H2 --> C2H6(g) delta Hrxn: H2(g) + 1/2O2 --> H2O (l) C2H4(g) + 3O2 --> 2H20(l) + 2CO2(g) C2H6(g) + 7/2O2(g) --> 3H20(l) + 2CO2(g) I know I have to flip the third reaction but I don't know what to do next

Physics
A volleyball is launched straight up at an initial velocity of 2.3 m/s. It is then spiked by a taller player 0.8 meters above the launch height. How high did it rise, and how long did the volleyball remain in the air between the players?

Science
So its the 1st one?:)

Science
When evolution was first proposed, which of the following was used as evidence to support the idea? 1.observations of nature 2.laboratory experiments 3.extensive fossil collections 4.genetic sequences I think its either 1 or 4

Math
What is the quotien of 148 ➗32 ? Help I need it now

Writing
I need help with writing an essay about simple questions, complicated questions, and complex questions. I need to make a topic, write 3-5 paragraphs, describe and explain, write it as an expository essay, and write one paragraph about how it helps us in every day life.

algebra math
Which one of the following is a geometric sequence? A. 2, –3, 9⁄2, −18⁄4 B. 0,1,2,3,... C. 8,4,2,1,1⁄2,1⁄4,... D. –7,10,23,36,.. i think the answer is D Can please check it ?

Fractions
Fiona and camila took a load of peaches to the farmers market. During the first hour , they sold 1/2 of the peaches plus 1/2 of a peach. In the second hour, they sold 1/3 of the remaining peaches plus 1/3 of a peach. In the third hour , they sold 1/4 of what was left and 3/4 ...

Math
Fiona and camila took a load of peaches to the farmers market. During the first hour , they sold 1/2 of the peaches plus 1/2 of a peach. In the second hour, they sold 1/3 of the remaining peaches plus 1/3 of a peach. In the third hour , they sold 1/4 of what was left and 3/4 ...

Chemistry
A buffer solution of volume 100.0 mL is 0.140 M Na2HPO4(aq) and 0.120 M KH2PO4(aq). What are the pH and the pH change resulting from the addition of 55.7 mL of 0.0100 M NaOH(aq) to the buffer solution?

Biology
Why can the identity of a compound not be determined by cutting out the spot on an autoradiogram and subjecting it to chemical analysis?

Eng
I'm doing project on What are Media racism on Islam & Muslim? Networks etc.and resources where can I can find it Thank you!

Stats
So i have a test in stats tomorrow and im trying to work on my study guide but im stuck at this question : Construct a confidence interval for the proportion for each case 90 percent interval 861 out of 2500. please help.

Chemistry
The change in mass was 0.0910g

Chemistry
Weight of empty crucible and cover = 23.104 g Weight of crucible, cover, MgO and Mg3N2 = 24.199 g Weight of crucible, cover, MgOand addition of H2O and heat = 24.290 Calculate the number of moles of Mg3N2.

Intermediate Algebra
it takes beth 6 hours to do homework and it takes nina 9 hours. how many hours would it take if they did their homework together?

physics
A shell is fired from the ground with an initial speed of 1.53 ✕ 103 m/s at an initial angle of 55° to the horizontal.

Chemistry
A 2.764 g sample containing only iron and aluminum metal was treated with acid to form Al(+3) and Fe(+2). The sample was then titrated with a potassium dichromate solution (only the Fe(II) will react with the dichromate). The sample was found to be equivalent to 14.36 mL of 0....

Physics
V = 1.5 * 10^6 m/s

Chemistry
A student determines the iron (II) content of a solution by first precipitating it as iron (II) hydroxide, and then decomposing the hydroxide to iron (II) oxide by heating. How many grams of iron (II) oxide should the student obtain if her solution contains 46.0 mL of 0.426 M ...

Chemistry
Calculate the number of milliliters of 0.782 M KOH required to precipitate all of the Mn2+ ions in 112 mL of 0.461 M Mn(NO3)2 solution as Mn(OH)2.

Physics
A balloon, when rubbed against denim, gains a charge of -10ìC. The force between the balloon and the denim when they are separated by a distance of 5 cm is:

u.s. history
How did the rise of labour unions shape relations among workers, big business, and government?

Chemistry
a 175.0 ml solution is made up of 20.0g of titanium(iii) chloride and H2O. What is it's molarity? I am just trying to check my work. M= 0.1296/0.175 =0.740

  1. Pages:
  2. <<Prev
  3. 1
  4. 2
  5. 3
  6. 4
  7. 5
  8. 6
  9. 7
  10. 8
  11. 9
  12. 10
  13. 11
  14. 12
  15. 13
  16. 14
  17. 15
  18. Next>>